GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-15 21:43:17, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_036253247            3619 bp    mRNA    linear   MAM 29-SEP-2020
DEFINITION  PREDICTED: Molossus molossus nuclear factor kappa B subunit 1
            (NFKB1), transcript variant X2, mRNA.
ACCESSION   XM_036253247
VERSION     XM_036253247.1
DBLINK      BioProject: PRJNA665629
KEYWORDS    RefSeq.
SOURCE      Molossus molossus (Pallas's mastiff bat)
  ORGANISM  Molossus molossus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Chiroptera; Microchiroptera;
            Molossidae; Molossus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_023425344.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Molossus molossus Annotation Release
                                           100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3619
                     /organism="Molossus molossus"
                     /mol_type="mRNA"
                     /isolate="mMolMol1"
                     /db_xref="taxon:27622"
                     /chromosome="Unknown"
                     /sex="male"
                     /tissue_type="muscle"
                     /dev_stage="adult"
                     /country="Panama: Gamboa"
                     /lat_lon="9.1165 N 79.6965 W"
                     /collection_date="2018"
                     /collected_by="Dina Dechmann"
     gene            1..3619
                     /gene="NFKB1"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 9 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 4 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:118624789"
     CDS             56..2965
                     /gene="NFKB1"
                     /codon_start=1
                     /product="nuclear factor NF-kappa-B p105 subunit isoform
                     X2"
                     /protein_id="XP_036109140.1"
                     /db_xref="GeneID:118624789"
                     /translation="
MAEEDPYLGGHEQMFHLDPLNHTIFNSEIFQSEMPLPTDGPYLQILEQPKQRGFRFRYVCEGPSHGGLPGASSEKNKKSYPQIKICNYSGPAKVIVQLVTNGKSIHLHAHSLVGKHCEDGICTVMAGPKDMVVGFANLGILHVTKKKVFETLEARMTEACIRGYNPGLLVHPDLAYLQAEGGGDRQLTDREKEIIRQAALQQTKEMDLSVVRLMFTAFLPDSTGSFTRRLEPVVSDAIYDSKAPNASNLKIVRMDRTAGCVTGGEEIYLLCDKVQKDDIQIRFYEEEENGGIWEGFGDFSPTDVHRQFAIVFKTPKYKDINITKPASVFVQLRRKSDLETSEPKPFLYYPEIKDKEEVQRKRQKLMPNFSDSFGGGGAGAGGGGMYGSGGGGGGTGSAGPGYGFPHYGFPYGGITFHHGATKSNAGMKHGAMDTSSKNDPGGCEESDDREAVSLSGEGTKTPEQHKGSSSRDDEATLAYPVGVKEENSGFLDSLFLEKAMQLARRHANALFDYAVTGDVKMLLAVQRHLTAVQDENGDCVLHLAIIHLHAQLVRDLLEVTSGLVLDDIINMRNDLYQTPLYLAVITKQEAVVEDLLRAGVDLSLLDHLGNSVLHLAAKEGHDRILGTLLKHKKAALLIDHPNGEGLNAIHIAVMSNSMPCLLLLVAAGADVNAQEQKSGRTALHLAVEQDNISLAGCLLLEGDAHVDSTTYDGTTPLHIAAGRGSTRMAALLKAAGADPLLENFEPLYDLDDSWEKDGDDEGVVPGTTPLDMATNWQVFDILNGKPYEPEFTSDDLLAQGDMKQLTEDTKLQLYKLLEFPDPDKNWATLAQKLGLGILNNAFRLSPAPSKTLMDNYEVSGGTIRELMEALRQMGYTEAIEVLQAAFCASGTAGPSPLETAPQAHSRPLSPASTRQQLDELRDDSICDSGVETSFRKLSFTESLTSGSSLLTLNKMPHDYGQEGPIEGKI"
     misc_feature    176..781
                     /gene="NFKB1"
                     /note="N-terminal sub-domain of the Rel homology domain
                     (RHD) of nuclear factor of kappa B1 (NF-kappa B1); Region:
                     RHD-n_NFkB1; cd07935"
                     /db_xref="CDD:143651"
     misc_feature    order(218..220,224..229,233..238,245..256,479..481,
                     485..490,779..781)
                     /gene="NFKB1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:143651"
     misc_feature    800..1105
                     /gene="NFKB1"
                     /note="IPT domain of the transcription factor NFkappaB and
                     related transcription factors. NFkappaB is considered a
                     central regulator of stress responses, activated by
                     different stressful conditions, including physical stress,
                     oxidative stress, and exposure to...; Region:
                     IPT_NFkappaB; cd01177"
                     /db_xref="CDD:238582"
     misc_feature    order(803..805,809..817,821..829,947..955,992..994,
                     1028..1030,1085..1087,1094..1096,1100..1102)
                     /gene="NFKB1"
                     /note="ankyrin protein binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:238582"
     misc_feature    order(809..814,818..820,857..859,863..865,869..871,
                     968..973,980..982,986..988)
                     /gene="NFKB1"
                     /note="dimerization interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:238582"
     misc_feature    order(872..874,878..880,971..976)
                     /gene="NFKB1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238582"
     misc_feature    1676..1774
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    <1742..2167
                     /gene="NFKB1"
                     /note="Ankyrin repeat [Signal transduction mechanisms];
                     Region: ANKYR; COG0666"
                     /db_xref="CDD:223738"
     misc_feature    1784..1873
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    1877..1981
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    order(1985..1987,1991..1993,2003..2008,2015..2023,
                     2027..2032,2042..2044,2051..2053,2078..2080,2087..2089,
                     2093..2095,2105..2110,2117..2125,2129..2134,2147..2149,
                     2156..2158,2183..2185,2189..2191,2195..2197,2207..2212,
                     2219..2227,2231..2236,2246..2248,2255..2257,2282..2284)
                     /gene="NFKB1"
                     /note="oligomer interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:293786"
     misc_feature    1985..2080
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2087..2185
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2102..>2299
                     /gene="NFKB1"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:432791"
     misc_feature    2189..2284
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2483..2707
                     /gene="NFKB1"
                     /note="Death domain of the Nuclear Factor-KappaB1
                     precursor protein p105; Region: Death_NFkB1_p105; cd08797"
                     /db_xref="CDD:260063"
ORIGIN      
cggggagcccgcaggcgccgggaggccgcgcgccgacgcgccaccaggctccaaaatggcagaagaggatccatatttgggagggcatgaacaaatgtttcatttggatcctttgaatcatacaatatttaattcagaaatatttcagtcagagatgccactgccaacggatggcccataccttcaaatattagagcaacccaaacagagaggatttcgtttccgttatgtctgtgaaggcccgtcccatggcggactccccggtgcatctagtgagaagaataagaagtcctaccctcagatcaaaatctgcaactactcgggacctgccaaggttattgttcagttggtcacaaatggaaaaagcatccacctgcacgcacacagcctggtggggaagcactgtgaggacgggatctgcaccgtaatggctggacccaaggacatggtggtcggctttgcaaacctgggtatacttcatgtgacaaagaaaaaagtatttgaaacactggaagcacgaatgacagaggcatgtataaggggctataatcccggacttttggtgcatcctgatcttgcctatttgcaagcagaaggtggaggagaccggcagctcacagatcgggaaaaggagatcatccgccaggcagctcttcagcagacaaaggagatggacctcagcgtggtgcggctcatgtttacagctttcctcccagacagcaccgggagcttcaccaggcgcctggaacccgtggtatcagacgccatctacgacagcaaagcccccaacgcgtccaacttgaaaattgtacgaatggacaggacagctggatgcgtcactggaggggaagaaatttatcttctctgtgacaaggttcagaaagatgacatccagattcgattttatgaagaggaggaaaatggtggaatctgggaaggatttggagatttttcccctacagacgttcacagacaatttgccatcgtcttcaaaacaccaaagtataaagacatcaacattaccaaaccagcctctgtgtttgtccaactacggaggaaatctgatttggaaactagtgaaccaaaaccttttctctactaccctgaaatcaaagacaaagaggaagtgcagaggaagcggcagaagctcatgcccaatttctcggacagctttggcggcggtggtgccggggctggaggcggaggcatgtacggcagcggcggtggaggagggggcacaggaagcgccgggccagggtatggcttcccccactatggatttccatatggtggaatcaccttccaccatggagccactaaatctaatgctgggatgaagcatggagccatggacacatcatctaaaaatgaccctggaggttgtgaggagagtgatgacagagaggctgtaagtctctctggggaaggaaccaaaaccccagagcaacataaggggtccagcagcagagatgatgaggctactctggcctatccagtgggagtgaaggaagagaattctgggtttctggacagcctcttcctggagaaggcaatgcagcttgccaggcggcacgccaacgccctgtttgactatgcggtgacaggagatgtgaagatgctgctggctgtccagcgtcacctcactgccgtgcaggatgagaacggggactgtgtcttacacttagcaatcatccacctccatgctcaacttgtgagggatctgctagaagtcacttctggtttggttttagatgacattatcaacatgagaaatgatctgtaccagacgcccttgtacttggcagtgatcaccaagcaggaggctgtggtggaggacttgctcagggctggggtcgatctgagccttctggaccacttgggtaactctgttttacacctagctgccaaagaaggacatgatagaattctcggtactttactcaagcacaaaaaggcagcactacttatcgaccaccccaatggggaaggtctgaacgccatccacatcgcggtgatgagcaacagcatgccctgtctgctgctgctggtggccgccggggcggacgtcaacgcgcaggagcagaagtcgggtcgcacggcgctgcacctggctgtggagcaggacaacatctccctggctggctgtctgctcctggagggtgatgcccacgtagacagtaccacctacgacggaactacaccgctgcacatagcggccgggagaggctccacccggatggcagcccttctgaaagcagcaggagcagatcctctgctggagaactttgagcctctctatgacctggacgattcctgggaaaaggatggagatgatgaaggagttgtgcctggaaccacacctctagatatggccaccaactggcaggtattcgacatattaaatgggaagccgtatgagccagagtttacatctgatgatttattggcacaaggagacatgaaacagctgactgaagacacaaagttgcagctttacaagttgctagaatttcccgatccagacaaaaactgggcaactctggcacagaaattaggtctggggatactcaataatgccttccggctgagtcctgctccttctaaaacgctcatggacaattacgaggtctctggagggaccataagagagctgatggaagccctgaggcagatgggctacaccgaagcgatcgaggtgctccaggccgccttctgcgcctcaggaactgcaggccccagcccactggagaccgccccgcaggcccactcgcggcctctctcacccgcctccaccagacagcaactagacgagctccgagacgacagcatctgtgacagcggcgtggagacatccttccgcaaactcagcttcacggagtctctgaccagcggcagctcattgctaactcttaacaaaatgccccacgattacgggcaggaaggacctatagaaggtaaaatttagccttctggcagttcccagcatcctgtaaaccaaagttctgaaattccactggactgtccaagagaaggaagggaaagtgcatccaggggtgctcagaggaacaccggccgccctggacagcgctgggcttcactcgaggcctctgagacccggctgccttcctcggctctccagggaatttcagcccggctcactggcatatagtctctagcaggcacggccttcggcggggctggtgcctcgtggaggtgaggtaccttgttgagctttaccggctgcttcctgtcatcattgctgctccccctctgctgtgtccccactgccattacaaggttaagtccccacctggtgtctttctcgccggccacagcacagtcgtgcactcagattaagaattaaggaaattcttaatattttatcaagaatattttaaataagatattttaaaaggcgccatcagtgtataattgaaagaggcttactgctttttctcacgtggtgtatctctgtgatttgaaaaaagaacatgtatgtgtcgatatttaaacatggttacaatcagtgctgaaaatggtcttttcccctttttctgcattttgctattgtaaatatgtttttagatcaaatactttaaaagaaagaatgttggattta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]