LOCUS       XM_036101330            6702 bp    mRNA    linear   MAM 12-DEC-2025
DEFINITION  PREDICTED: Halichoerus grypus ATPase copper transporting beta
            (ATP7B), transcript variant X2, mRNA.
ACCESSION   XM_036101330
VERSION     XM_036101330.2
DBLINK      BioProject: PRJNA1375836
KEYWORDS    RefSeq.
SOURCE      Halichoerus grypus (gray seal)
  ORGANISM  Halichoerus grypus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Carnivora; Caniformia;
            Pinnipedia; Phocidae; Phocinae; Halichoerus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_135715) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Dec 12, 2025 this sequence version replaced XM_036101330.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_964656455.1-RS_2025_12
            Annotation Pipeline         :: NCBI Eukaryotic Genome Annotation
                                           Pipeline (EGAP)
            Annotation Software Version :: 10.5
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 12/10/2025
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..6702
                     /organism="Halichoerus grypus"
                     /mol_type="mRNA"
                     /db_xref="taxon:9711"
                     /chromosome="4"
                     /geo_loc_name="United Kingdom:Scotland | Monach Isles"
                     /collection_date="2021-11-03"
     gene            1..6702
                     /gene="ATP7B"
                     /note="ATPase copper transporting beta; Derived by
                     automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 6 Proteins, and 100% coverage of the annotated genomic
                     feature by RNAseq alignments, including 1 sample with
                     support for all annotated introns"
                     /db_xref="GeneID:118541613"
     CDS             345..4643
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X2"
                     /protein_id="XP_035957223.1"
                     /db_xref="GeneID:118541613"
                     /translation="

MKQSFAFDNVGYEGGHDGVCPPQTTSSTISISGMTCQSCVKSIEGRISSLKGIVSIKVSLEQGSATVKYVPSILSLPQICRHIEDMGFEASIAEGKAASWPSRSSPGLEAVVKLRVEGMTCQSCVSSIEGRLGKLQGVVRVRVSLGTQEAVITYQPYLIQPQDLRDHVNDMGFEAVIKNRVAPVSLGPIDIGRLQRTDPKTPSASDNQNLNNSEPSGHHGSHVVTLQLRVDGMHCKSCVLNIEENIGQLPGVQNIQVSLENRIAQVQYDPSRITADALQRAIEALPPGDFKVSLPDGAAGGGAGSRSSNRAAPAPAPRTQEPGVCSTVVLAIAGMTCASCVQSIEGLVSQREGVQQISVSLADGTGVVLYDPSVINPEELRAAVEEMGFETSVLFENCYSNHVGNHSAGNSSAHPTAGVPVSVQEEAPHAGGLPKNHSPGSSSKSPQASTTAAPQKCFLQITGMTCASCVSNIERNLQKEAGILSVLVALMAGKAEVKYNPEVIQPLEIARLISDLGFEAVVMEDYTGSDGDLELIITGMTCASCVHNIESKLTRTNGITYASVALATSKAHVKFDPEIIGARDIVRIIEEIGFHASPAQRNPSAHHLDHKVEIKQWKKSFLCSLVFGIPVMGLMIYMLVPSNEPHESMVLDHNIIPGLSILNLIFFILCTFVQLLGGWYFYVQAYRSLRHRAANMDVLIVLATSIAYTYSLLILVVAVAEKAERSPVTFFDTPPMLFVFIALGRWLEHVAKSKTSEALAKLMSLQATEATVVTLGEDNLIIREEQVPMELVQRGDIIKVVPGGKFPVDGKVLEGNTMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVNATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADRFSGYFVPFIIIISTLTLVVWIIIGFIDFGVVQKYFPTPNKHISQAEVIIRFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITHGVPKVMRVLLLVDVATMPLRKVLAVVGTAEASSEHPLGMAVTKYCKEELGTETLGYCTDFQAVPGCGIGCKVSSVEGILAPGERQQSKQAAPLSRTGSVPEATDATPQTFSVLIGNREWMRRNGLTISSDISDAMTDHEMKGQTAILVAIDGVLCAMIAIADAVKQEAALAVHTLKSMGVDVVLITGDNRRTARAIATQVGINKVFAEVLPSHKVAKVQELQNEGKKVAMVGDGVNDSPALARADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVWRIRLNLVLALIYNLIGIPIAAGVFMPIGIVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDLERYEAQAQGRMKPLTASQVSVHIGMDDRRRDSPRATPWDQVSFISQVSLSSLKSDKLSRHSAAADDGGDKWSLLLNDRDEEQCI"

     misc_feature    426..617
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(444..452,459..461)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    681..869
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(699..707,714..716)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1023..1199
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1041..1049,1056..1058)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1323..1514
                     /gene="ATP7B"
                     /note="Copper chaperone CopZ [Inorganic ion transport and
                     metabolism]; Region: CopZ; COG2608"
                     /db_xref="CDD:442020"
     misc_feature    1719..1904
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1734..1742,1749..1751)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1944..2135
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1962..1970,1977..1979)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2199..4307
                     /gene="ATP7B"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(3192..3194,3198..3200,4236..4238)
                     /gene="ATP7B"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(3324..3332,3534..3536,3687..3695,3783..3785,
                     3903..3911,3969..3971,3978..3980,3987..3989,4044..4046,
                     4053..4055)
                     /gene="ATP7B"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      

aggcgcggatcggagagggagctgtgcggagcggatccgtagccggcgcccgccacgccgcaccttccccgccggcggttggcgagccctgggatctgcatctccggtccggctctgcgccgctctcccgccctcctgtccttctccgcacacgccggaggccgaagaccgagtccgcagcgcaccggcccgaggtgacctgtgggctctgggccgatcacagaagaaattggctcctccggaggaggttgcttgaacaggaaagacagattacagccagagaagaggccagtcggaaaatcctgtctaaactttctctgcccgctcgtgccggggagccagcaatgaagcagagtttcgccttcgacaatgttggctatgaaggcggccatgatggcgtgtgcccccctcagacgaccagcagcaccatcagcatttcgggcatgacttgccagtcgtgtgtaaagtctatcgagggcaggatttccagcttgaaaggcattgtgagcattaaggtttccctggaacaaggcagcgcgaccgtgaagtacgtgccgtccatcctgagcctgccgcagatttgccggcacattgaggacatgggctttgaggccagcatcgcagaaggaaaggccgcctcctggccttcaaggtcctcgcctggcctggaggccgtggtcaagctccgggtggagggcatgacctgccagtcctgcgtcagctccattgaaggcaggcttgggaaactgcaaggggtagtgagggtccgagtgtccctcggcacccaggaagcagtcattacctaccagccttatctcatccagccccaggacctcagggaccatgtcaacgacatgggctttgaagctgtcatcaagaacagagtagcgcccgtaagcctgggacccattgatattgggcggttacagaggaccgacccaaagacaccttcggcttctgataaccagaatctcaataactctgagccctcggggcaccacgggagccacgtggtcaccctgcaactgagagtagatggaatgcactgtaagtcttgtgtcctgaatattgaagaaaacataggccaactccctggggttcaaaatattcaagtgtccttggagaacagaatcgcccaagtacagtacgacccttctcgtatcactgcagacgccctgcagagggccatcgaagctcttccacctggggactttaaagtctctcttcctgatggagcagcagggggtggggcaggtagcaggtcttccaaccgtgcggcccccgcccccgccccgagaacccaggagccgggcgtgtgcagtaccgtggtgctcgccattgctggaatgacctgtgcgtcctgtgtccagtccatcgaaggcctggtctcccagagggaaggggtgcagcaaatatcagtctctctggctgacgggaccggagtggtgctctatgatccctctgtaattaacccggaagaactccgagctgctgttgaagaaatgggatttgagacttcagtcctttttgaaaactgttacagcaaccatgttggaaaccacagtgctgggaattcctcagcgcaccccacagctggcgtacctgtgtctgtgcaggaagaggctccccatgctggggggctccctaaaaaccacagccccggctcctcgtccaagtccccgcaagcctctaccacagcggcacctcagaagtgctttttacagatcacaggcatgacctgtgcatcctgtgtgtccaacatagagagaaacctgcagaaagaagcaggtattctctcggtgctggttgccctgatggccgggaaggcagaggttaagtataacccagaagtcatccagccactggagatagctcggctcatcagtgacttgggctttgaggcggtggtaatggaagactacacaggctcagacggcgacctcgagctgatcatcacggggatgacctgcgcatcctgtgttcacaacatagagtccaaactcacaaggacaaacggcatcacctacgcgtctgtggcccttgccaccagcaaagcccatgtgaagttcgatcctgaaattatcggtgcacgggatattgtccgaattatcgaggaaatcggctttcatgcttccccggcccagagaaaccccagcgcgcatcacttggaccacaaggtggaaataaagcagtggaagaagtcttttctgtgcagcctggtgttcggcatccctgtcatgggtctgatgatctatatgttggtgcccagcaacgagccccacgagtctatggtcctggaccacaacatcattccaggactgtccattctaaatctcatcttctttatcttgtgtacctttgtccagctccttggcgggtggtacttctacgtccaggcctacagatctctgaggcacagggcggccaacatggatgtgctcattgtgctggccaccagcatcgcctacacctactcgctcctcatcctggtggtggctgtggccgagaaggcggagaggagccctgtgaccttcttcgacacccctcccatgctctttgtgttcattgccctggggcggtggctggaacacgtggcaaagagcaaaacctcagaagcccttgccaaactcatgtctctccaagccacggaagccactgttgtgacccttggcgaggacaacttgatcatcagagaggagcaggtacccatggagctggtgcagcggggcgatatcatcaaagttgtccccgggggaaagttcccagtggatgggaaagtcctggaaggcaacaccatggccgacgagtccctcatcacaggagaagccatgcccgtcacgaagaaacctggaagcacagtgattgctgggtctataaatgcacacggctctgtgctcgttaatgccacccatgtgggcaatgacaccacgttggctcagattgtgaaattggtggaagaggctcagatgtcaaaggcacccattcagcaactggctgaccggtttagtggatattttgtcccatttatcatcatcatttcaacgttgacgttggtggtatggattataatcggttttatcgattttggtgttgttcagaaatactttcctacccccaacaagcatatctcccaggcagaggtgatcatccggtttgcgttccagacatccatcacggtgctgtgcatcgcctgcccctgctccctgggcttggccacgcccacggcggtcatggtgggcaccggggtggccgcccagaatggcatcctcatcaaaggaggcaagcctctggagatggcgcacaagataaagaccgtgatgtttgacaaaactggcaccattacccacggggtccccaaagtcatgagggtcctcctgcttgtggatgtggccacgatgcccctcaggaaggttcttgctgtggtggggactgcggaggccagcagcgagcaccctttgggcatggcagtcaccaagtactgtaaagaggaattgggaaccgagaccttgggatactgcacggacttccaggcagtgccgggctgtggcatcggctgcaaagtcagtagcgtggagggcatcctggcccccggcgagcgccagcagagcaaacaggctgctcccctgagcaggactggcagcgttcccgaggcaacagatgcgaccccccagaccttctctgtgctgattgggaaccgcgaatggatgaggcgcaacggcctaaccatttccagcgacatcagtgatgcgatgacagatcatgagatgaaaggccagacggccatcctggtggccattgacggcgtgctctgcgccatgatcgccatcgcggatgcagtcaagcaggaggcagccctggccgtgcacacgctgaagagcatgggtgtggacgtggttctgatcacaggggacaaccggaggacagccagagccatcgccacccaggttggcatcaacaaggtctttgcagaggtcctgccttctcacaaggtggccaaggtccaggagctccagaatgaagggaagaaggtcgccatggtgggagatggggtcaatgactcaccggccttggcccgggccgatgtgggcattgccatcgggacaggcacggacgtcgccattgaggctgctgacgttgtcctcatcagaaacgatttgctcgatgtggtggctagcattcacctgtccaagaggaccgtctggagaatacgcctcaatctggtgctggcgttgatttataacctgatcggaatacccattgccgcaggggtcttcatgcccatcggcatcgtgctacagccgtggatgggctcggcagccatggcggcctcctccgtgtctgtggttctctcatcgctgcagctcaagtgctataagaagcccgacctggagaggtatgaggcgcaggcccagggccgcatgaagcccctgacggcgtcgcaggtgagcgtgcacatcggcatggatgaccggcgacgggactccccgagggccacgccctgggaccaggtcagcttcatcagccaggtgtctctgtcctccctgaagtccgacaagctgtctcgacacagtgctgcggctgatgacggtggggacaagtggtctctgctcctgaatgacagagatgaggagcagtgcatctgaaagctccaggcgggtgcagagccaggggtccgtctcctcagcgagtagccggcccggctttcccggggccgaggctcaggccgaacaggtgcggcaccagcagcaggatgggcgaagctcccctcagccatggggacttctactccctggacattcctggtcatccctcctagcatgtgccacgtccagatgtggctcctgagtaggccccgcccccacccccccgtgcctggatcccaccagcacaggggccaggcttcccggcctgaccatgctgttggcctgggcttgtcgggaaccttgctggactctagcagaagagaggacagccagccctcctcacagacctctgctttagtgtttggaatgactgcttgtaaaatgaggaaaatctcaccaggaccaaaaacttagctgggcctttccttagaactcacgagaagccttgtgttgggttctttttgacaacacccacatgcgttgcgtatctgagaccacagtttacctcaaatacaccccactgacatctgccggcatcgtctcttccttttctgttcttcacactggggccagcccaccccagcccacccctgccagatctctgacagcaggaccctagtgatccctgctgttgccctcaggcctgcatctgctccctctcgcgccggccagagagcccgccttgcttctcttcaggctgaggagagttctctcctgcctgtgtgccccctggccacggagtcctggcttctcgctcctcggaatggcgtgctcttgtggattgttgccgccccgctggagtgagggtctcagagcctgagacctgggaaatcctgcctcctgtggggtccaggtccttgggacatgcggaggcctgtcgtgcttgaaaccgcgtcccgcggggaggtgtgtgcgcttgccagaccgccttgcacgcctccgggagcttcagtgacatggtctgctatgggactgtcagctcgcggagttcagtagagttcatgtccgtggtgctcctgctggcgtccaaatgcatggaaacccgtacccgaagaagagggaatcacactctccaggagcttctgcttgtgcacacggggctggcgccttaggaaaggagtcaccactgctgccccaagggagagcgtgtttcacactttcagtggctctttgtgattgtaggacatcagaggggcaggaatggggccagttttagacagtcaagtcggtggtgattggcggaaccacatggtagtacacgagtagaaaaaaaataaattttaaggtagagagagcccttatcacacacaaaatagttttatttattgagtaccagttatgtttcagggacagtgtaagcactttttctaggctacttgtaatcttcccaacaaaccggccaagtaaatactgctgtccccattggacgggcagggcggtaggctcagagaggctgggtatcccgcccaggatcgcacagcccgcgcacatgccagaacagggaagttttttctccgcggtggctgccaccaaaatatcagttggcaggaataaacaggaaaaagccacctgctcctagaagaacaagtctgctgggtgatcgattcattgttagcgacttggaatgaaacttgatctcgggatcagctcacctttccctcggatggtttgtttccatttttgcctataatctcgtgttgctgggtcttaccccctacaatcctgcagtgggttccattgtgttcctgtcgttttcagtcttcctttccctcgggcctcttcctgctctgtccttcctttattcctggctgtgctcaggagggtttcttgttttctaagtaggttaatcattgtctaaaggatctaattgtattgatttcacaaaggctttttaggaccataaacctcatgtgtatatggccatgaaaatatttatataattgtacagaatataacctttagatgttcaagaggtaagaattttttgtgtgtcagataagaagagttcctgtttcaaaaactttccatgctgtattagaataaagtttatttttattca

//