2025-08-29 09:16:11, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS XM_035966452 1844 bp mRNA linear PLN 20-FEB-2025 DEFINITION PREDICTED: Zea mays protein argonaute 1B (LOC103651475), transcript variant X2, mRNA. ACCESSION XM_035966452 VERSION XM_035966452.1 DBLINK BioProject: PRJNA655717 KEYWORDS RefSeq. SOURCE Zea mays ORGANISM Zea mays Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; PACMAD clade; Panicoideae; Andropogonodae; Andropogoneae; Tripsacinae; Zea. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_050098.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Updated annotation Annotation Name :: GCF_902167145.1-RS_2025_02 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.3 Annotation Method :: Best-placed RefSeq; Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 02/14/2025 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1844 /organism="Zea mays" /mol_type="mRNA" /cultivar="B73" /db_xref="taxon:4577" /chromosome="3" gene 1..1844 /gene="LOC103651475" /note="protein argonaute 1B; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 15 long SRA reads, and 91% coverage of the annotated genomic feature by RNAseq alignments, including 59 samples with support for all annotated introns" /db_xref="GeneID:103651475" CDS 1049..1639 /gene="LOC103651475" /codon_start=1 /product="protein argonaute 1B isoform X2" /protein_id="XP_035822345.1" /db_xref="GeneID:103651475" /translation="
MGLSLNIDMSSTAFIEPLPVIDFVAQLLNRDISVRPLSDSDRVKIKKALRGVKVEVTGNMRRKYHISGLTSQATRELSFPVDDRGTVKTVVQYFMETYGFSIQHTTLPCLQVGNQQRPNYLPMEVCKIVEGQHYSKRLNEKQITALLKVTCQRPQERELDILQDSGSHQVTPPPHDDFADKCLHSSGGAMNNNPMS"
misc_feature 1097..1435 /gene="LOC103651475" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(1238..1240,1283..1285,1316..1318,1328..1330, 1382..1384,1403..1405,1409..1411) /gene="LOC103651475" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" ORIGIN
gacagtgacgacgatgttgatgaggatagaaaggaacaaatttctcattgattttttgagttgggaagtggcaaccacacttcaagtggtggtgctcgtacatctctttgttggactgcatgaatgtgcagggaacacaaaaaaacagatgtacaatcaatcctggtgacagtgctctctgtttggatgaaaggaacaaccatatgaccgtgtcctagcaaaagctgaataacaagtgaaaaaagctggaacctcaagcaaagtttgcatcagtagagaatttataaattcttcctttgtgtgaaatcaccatactgtaagaatgttcacttacgtttccgaataagaacttcaagggaagtgaatagttctatatgagcaatctttgcttagtctaatctcaatattggaaacaaatttaggtagctgagctgatatatgggcaagatactaaactcatgatcacttgctttattgcttccctcaattcatgagcatggatctatatgctggtccaacaactataaagcctgtcatgaataacataccttagcaataggttcagcctacaaattaacaatgttggttctatatgtatgtttggaattctatttagggctttatgttcctaaatgatttgtatcactgtggttcagtactatcaatatgcattgtgaattgtgatgttttgctgctattttgctatacaggtgaaggagcaaataagttagctgcaccatgttgtcaacttgtattttagaaattttctctttattattttagcaattccatgacgcagctgatattctatttgtcttacatcatttaccttttctacactccctaagctgatattctagctggaaggcaagcagatgcccctcaggaagctcttcaagtgcttgacattgtactacgtgaattgcctaccgcgaggtattctcctgttggtaggtcattttactctcccaacttagggagacgtcaaaaacttggtgagggattagaaagttggcgtggtttttaccaaagcataaggccgacacagatgggcctttcactgaatattgatatgtcctctactgcatttatcgagcctctccctgtgattgattttgttgctcagcttcttaacagagatatctcagttagaccattatctgattctgatcgcgtgaagattaaaaaagccctaagaggtgtgaaggttgaggtgactggaaacatgcgcagaaaatatcacatttctggcctcacctcacaagcaacaagagagctatcattccctgttgatgatcgtggtactgtgaagactgtggtgcaatacttcatggagacttatggttttagtatccagcacaccactttaccatgcttgcaagtgggcaatcaacaaagaccaaattatctgcctatggaggtttgcaagatagttgaaggacagcattactcaaagagactcaatgagaaacaaatcactgctctactgaaagtgacctgccagcgccctcaagagcgtgagctggacatcttacaggattccggctctcatcaagtgactcctccccctcacgatgactttgcggacaaatgtctccattctagtggtggagctatgaacaacaatccgatgtcctgatcgagagcgatggagctaatgtttgaacttgtgaactaaaaatgtgaactatggatgtgaacttatgtaaatttgtgaacttatgcatttggacttatgtgaatttgtgaacttatgtatttggacttgtgtgaatttgtgatatgaacatatatccatgtgtttgaaatctgtattgtatgtgatattctgtgttgcatgtgat
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]