2024-04-20 16:41:09, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_035817464 4284 bp mRNA linear INV 13-AUG-2020 DEFINITION PREDICTED: Branchiostoma floridae fibropellin-1-like (LOC118413867), transcript variant X7, mRNA. ACCESSION XM_035817464 VERSION XM_035817464.1 DBLINK BioProject: PRJNA33245 KEYWORDS RefSeq. SOURCE Branchiostoma floridae (Florida lancelet) ORGANISM Branchiostoma floridae Eukaryota; Metazoa; Chordata; Cephalochordata; Leptocardii; Amphioxiformes; Branchiostomatidae; Branchiostoma. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_049982.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Branchiostoma floridae Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.5 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..4284 /organism="Branchiostoma floridae" /mol_type="mRNA" /strain="S238N-H82" /db_xref="taxon:7739" /chromosome="4" /sex="male" /tissue_type="testes" /country="USA: Old Tampa Bay, Florida" gene 1..4284 /gene="LOC118413867" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 2 samples with support for all annotated introns" /db_xref="GeneID:118413867" CDS 35..3784 /gene="LOC118413867" /codon_start=1 /product="fibropellin-1-like isoform X7" /protein_id="XP_035673357.1" /db_xref="GeneID:118413867" /translation="
MSVQGGSWLLLTGLALFFSYSAAVCPLPNYTPTSIDGYCYREKVGMFDFHAAEHICEEDGALLITDKNIYRHMWLQLKDFAQGFWLGLEDEEVPGEYYWSDNETLSEPTFWEPTIPDDPSKHCVISVRNGTGGVTAQSNWVPADCHSYYTNVVCEVDNDECASNTENACNEPNMHCVNTIGWYECECDAGYHWEGNICAEEHIGPTEAPIHDECPVGWDDTFTGMCIKAFTVKSNWPMAHFTCGTSERGRLVTIEDQEKLDFMKTYADAPNYYWIGLNDVMEEGTLVWTDGDDLDPAEFTPAVPWSSDPNYQNTDAIDCVCFAKGILNGVYNTWAFESCLTKKKFICEIDLDECSAKPCLNNGTCYEEHPVGFGCTCEPGYEGDICEIDVDECANVTCENGGTCVDGINEYSCDCPIGIEGTHCEINIDDCPGVTCQNGGTCVDGINDYSCDCVDGYEGEHCETETDECDPDPCQNGGTCTDSLNAFDCSCTPGWEGDTCETNTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVDCQNGGTCVDEVDGYSCTCVPGYEGDHCETDTDDCVGVTCPNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVDCQNGGTCVDEVDGYSCTCVPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDDVNGYSCTCAPGYQGDHCETDTDDCLGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVDCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDECSSEPCLNGGTCEDDISGYTCTCALNYEGDHCETGCEAGYWLYNGRCYWFSDFWREYSDAEDACATRGSLLATVKDAGTHGFLSTQIQATQDGRSHWIGLTDRVTDGEYVWSDGTSLGSYQPWRTGEFGFGDHTRKGCVMLWHTRNFSWATTQCEHRWNLYFICEKAAVTTTP"
misc_feature 146..502 /gene="LOC118413867" /note="C-type lectin (CTL)/C-type lectin-like (CTLD) domain; Region: CLECT; cd00037" /db_xref="CDD:153057" misc_feature order(395..397,407..409,413..415,431..433,455..466, 473..481) /gene="LOC118413867" /note="ligand binding surface [chemical binding]; other site" /db_xref="CDD:153057" misc_feature 674..1078 /gene="LOC118413867" /note="C-type lectin (CTL) or carbohydrate-recognition domain (CRD); Region: CLECT; smart00034" /db_xref="CDD:214480" misc_feature order(977..979,1007..1009,1013..1015,1031..1033, 1037..1048,1055..1063) /gene="LOC118413867" /note="ligand binding surface [chemical binding]; other site" /db_xref="CDD:153057" misc_feature 1199..1309 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(1199..1201,1208..1210,1250..1252) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 1313..1423 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(1313..1315,1322..1324,1364..1366) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 1433..1537 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature 1541..1651 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(1541..1543,1550..1552,1592..1594) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 1655..1765 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(1655..1657,1664..1666,1706..1708) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 1769..1879 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(1769..1771,1778..1780,1820..1822) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 1883..1993 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(1883..1885,1892..1894,1934..1936) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 1997..2107 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(1997..1999,2006..2008,2048..2050) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 2111..2221 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(2111..2113,2120..2122,2162..2164) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 2225..2335 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(2225..2227,2234..2236,2276..2278) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 2339..2449 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(2339..2341,2348..2350,2390..2392) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 2453..2563 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(2453..2455,2462..2464,2504..2506) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 2567..2677 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(2567..2569,2576..2578,2618..2620) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 2681..2791 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(2681..2683,2690..2692,2732..2734) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 2795..2905 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(2795..2797,2804..2806,2846..2848) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 2909..3019 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(2909..2911,2918..2920,2960..2962) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 3023..3133 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(3023..3025,3032..3034,3074..3076) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 3137..3247 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(3137..3139,3146..3148,3188..3190) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 3251..3361 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(3251..3253,3260..3262,3302..3304) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 3368..3757 /gene="LOC118413867" /note="C-type lectin (CTL) or carbohydrate-recognition domain (CRD); Region: CLECT; smart00034" /db_xref="CDD:214480" misc_feature order(3668..3670,3680..3682,3686..3688,3704..3706, 3710..3721,3728..3733,3740..3742) /gene="LOC118413867" /note="ligand binding surface [chemical binding]; other site" /db_xref="CDD:153057" ORIGIN
ctacaccgcacgcggcccagggatacccgcagacatgtctgtacagggaggctcgtggctgcttctgacgggcctggcgttgttcttctcctactctgcagccgtgtgcccactaccaaactacacaccgaccagcatcgacgggtactgctaccgggagaaagtggggatgtttgacttccatgcggccgagcacatttgtgaagaggacggtgctctcctcataacggataaaaacatatacagacatatgtggctccagttgaaagacttcgctcagggattctggctcggattggaggacgaagaggttccaggagagtactactggagtgacaatgaaactttgtccgagccgacattttgggaacctacaattcccgacgacccctcaaagcactgcgtcatctctgttcgaaatgggaccggaggagtcaccgcacagtcgaactgggtgcctgcggactgccacagctactacaccaacgtcgtctgtgaagttgataacgatgaatgtgcatcgaacacagagaacgcctgcaacgaacccaacatgcactgcgtgaacaccatcggctggtacgagtgtgagtgcgatgcagggtaccactgggagggcaacatatgtgccgaggagcacatcggcccgactgaagccccgatacacgatgaatgccccgtgggctgggacgacaccttcacgggcatgtgcatcaaggcgtttaccgtaaagtccaactggcccatggcgcattttacgtgcggcacgtcggagagggggcggctggtgaccatcgaagaccaggaaaagttagatttcatgaaaacttacgccgatgctcctaactactattggatcggattgaacgatgtgatggaggagggaacacttgtgtggacagacggggacgacctggaccctgccgagtttacccccgccgtcccgtggtcttcagaccccaattaccagaacacagacgccattgactgcgtctgcttcgccaaaggcatactcaatggcgtgtacaacacgtgggctttcgagtcatgtttaacgaagaaaaaattcatctgcgagatcgatctggacgagtgcagtgctaagccatgtctcaacaacggcacttgttacgaggagcaccctgtagggttcggctgcacatgcgaaccaggctacgaaggagatatctgcgagatagatgtagacgaatgcgctaacgtgacctgtgagaacggcggaacctgcgtcgacggcatcaacgaatactcctgcgattgtcctattggcattgaaggcactcactgcgaaataaatatagacgattgtcctggcgtgacctgtcagaacggcggaacctgcgtcgatggcatcaacgactactcctgcgactgtgttgatggctatgaaggcgagcactgtgaaacagagacagacgagtgtgatcccgatccgtgccagaacggcggaacctgtacggactcacttaatgccttcgactgctcgtgcacgcctggatgggagggggatacatgtgaaacaaatacggacgactgcgttggagtgaattgtcaaaatggcggaacctgcgtcgacgaagtggacggttactcctgcacttgtgctcctggctatgaaggtgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgaattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgttggagtggattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgttcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtccaaatggcgggacctgcgtcgacgaagtggacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatggcgggacctgcgtcgacgaagtggacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgaattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgttggagtggattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgttcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatggcgggacctgcgtcgacgaagtggacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgaattgtcaaaatggcgggacctgcgtcgacgatgttaacggttactcctgcacatgtgctcctggctatcaaggcgatcactgtgaaacagatacggatgactgccttggagtgaattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgttggagtggattgtcaaaatggcggaacctgcgtcgacgaagtggacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgttggagtgaattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgttggagtgaattgtcaaaatggcggaacctgcgtcgacgaagttgacggttactcctgcacttgtgcacctggctatgaaggcgatcattgtgaaacagacacggacgaatgtagctccgagccctgtctaaacggtggaacttgcgaggatgacatcagtggctacacctgcacgtgtgctcttaactatgaaggagatcattgtgaaaccggttgtgaggccggttactggttatacaacggcagatgctactggttctctgacttctggcgcgaatacagcgacgcggaggacgcatgcgccacaagaggttcccttctggcgacggtgaaggatgccgggacgcacggcttcctttcaacgcagatccaagccacccaagatggaaggagccactggatcgggctgactgaccgagtaacggacggggagtacgtctggagtgacgggacctcgctcgggtcttaccaaccctggaggacaggggagttcgggttcggcgaccacacccggaaaggttgcgtcatgctgtggcacaccaggaacttcagctgggccaccacgcagtgtgagcataggtggaacctctacttcatctgcgagaaggctgctgtgacaacgactccatagccatcgcggcttcgacagaactaaacgttaccatgacaactgacttggatctgacggtttttttcgactaaagaacccaaggtttaactgagaacaaagatgcccaatatcaactctgttcatatttatagatagatcttaacagtcttattgctcataaacgctaatgtatactattagatatttctctaaatgccacagttgctgctttgattgtttgcccttgtgtcacacataccagcacctgcaatgcgtcatattttttcaacatctgtagtggcaagaccattcttaagaggacgattgattaaaaagaaaataactcccaaccacgggaactttgaacgtactatggtcccaactatggttaactatggtcccaactatggtcccaactatggtcccaactatggtcccaactatggtcccaactatggtcccaactatggttccaactatggtcccaactatggtcccgactgtgatcctaactatggtcc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]