ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2024-04-19 18:34:22, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_035817463 4398 bp mRNA linear INV 13-AUG-2020
DEFINITION PREDICTED: Branchiostoma floridae fibropellin-1-like
(LOC118413867), transcript variant X6, mRNA.
ACCESSION XM_035817463
VERSION XM_035817463.1
DBLINK BioProject: PRJNA33245
KEYWORDS RefSeq.
SOURCE Branchiostoma floridae (Florida lancelet)
ORGANISM Branchiostoma floridae
Eukaryota; Metazoa; Chordata; Cephalochordata; Leptocardii;
Amphioxiformes; Branchiostomatidae; Branchiostoma.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NC_049982.1) annotated using gene prediction method: Gnomon.
Also see:
Documentation of NCBI's Annotation Process
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI
Annotation Status :: Full annotation
Annotation Name :: Branchiostoma floridae Annotation
Release 100
Annotation Version :: 100
Annotation Pipeline :: NCBI eukaryotic genome annotation
pipeline
Annotation Software Version :: 8.5
Annotation Method :: Best-placed RefSeq; Gnomon
Features Annotated :: Gene; mRNA; CDS; ncRNA
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..4398
/organism="Branchiostoma floridae"
/mol_type="mRNA"
/strain="S238N-H82"
/db_xref="taxon:7739"
/chromosome="4"
/sex="male"
/tissue_type="testes"
/country="USA: Old Tampa Bay, Florida"
gene 1..4398
/gene="LOC118413867"
/note="Derived by automated computational analysis using
gene prediction method: Gnomon. Supporting evidence
includes similarity to: 100% coverage of the annotated
genomic feature by RNAseq alignments, including 2 samples
with support for all annotated introns"
/db_xref="GeneID:118413867"
CDS 35..3898
/gene="LOC118413867"
/codon_start=1
/product="fibropellin-1-like isoform X6"
/protein_id="XP_035673356.1"
/db_xref="GeneID:118413867"
/translation="
MSVQGGSWLLLTGLALFFSYSAAVCPLPNYTPTSIDGYCYREKVGMFDFHAAEHICEEDGALLITDKNIYRHMWLQLKDFAQGFWLGLEDEEVPGEYYWSDNETLSEPTFWEPTIPDDPSKHCVISVRNGTGGVTAQSNWVPADCHSYYTNVVCEVDNDECASNTENACNEPNMHCVNTIGWYECECDAGYHWEGNICAEEHIGPTEAPIHDECPVGWDDTFTGMCIKAFTVKSNWPMAHFTCGTSERGRLVTIEDQEKLDFMKTYADAPNYYWIGLNDVMEEGTLVWTDGDDLDPAEFTPAVPWSSDPNYQNTDAIDCVCFAKGILNGVYNTWAFESCLTKKKFICEIDLDECSAKPCLNNGTCYEEHPVGFGCTCEPGYEGDICEIDVDECANVTCENGGTCVDGINEYSCDCPIGIEGTHCEINIDDCPGVTCQNGGTCVDGINDYSCDCVDGYEGEHCETETDECDPDPCQNGGTCTDSLNAFDCSCTPGWEGDTCETNTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVDCQNGGTCVDEVDGYSCTCVPGYEGDHCETDTDDCVGVTCPNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVDCQNGGTCVDEVDGYSCTCVPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDDVNGYSCTCAPGYQGDHCETDTDDCLGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVDCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCVPGYEGDHCETDTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDECSSEPCLNGGTCEDDISGYTCTCALNYEGDHCETGCEAGYWLYNGRCYWFSDFWREYSDAEDACATRGSLLATVKDAGTHGFLSTQIQATQDGRSHWIGLTDRVTDGEYVWSDGTSLGSYQPWRTGEFGFGDHTRKGCVMLWHTRNFSWATTQCEHRWNLYFICEKAAVTTTP"
misc_feature 146..502
/gene="LOC118413867"
/note="C-type lectin (CTL)/C-type lectin-like (CTLD)
domain; Region: CLECT; cd00037"
/db_xref="CDD:153057"
misc_feature order(395..397,407..409,413..415,431..433,455..466,
473..481)
/gene="LOC118413867"
/note="ligand binding surface [chemical binding]; other
site"
/db_xref="CDD:153057"
misc_feature 674..1078
/gene="LOC118413867"
/note="C-type lectin (CTL) or carbohydrate-recognition
domain (CRD); Region: CLECT; smart00034"
/db_xref="CDD:214480"
misc_feature order(977..979,1007..1009,1013..1015,1031..1033,
1037..1048,1055..1063)
/gene="LOC118413867"
/note="ligand binding surface [chemical binding]; other
site"
/db_xref="CDD:153057"
misc_feature 1199..1309
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(1199..1201,1208..1210,1250..1252)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 1313..1423
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(1313..1315,1322..1324,1364..1366)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 1433..1537
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature 1541..1651
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(1541..1543,1550..1552,1592..1594)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 1655..1765
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(1655..1657,1664..1666,1706..1708)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 1769..1879
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(1769..1771,1778..1780,1820..1822)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 1883..1993
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(1883..1885,1892..1894,1934..1936)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 1997..2107
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(1997..1999,2006..2008,2048..2050)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 2111..2221
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(2111..2113,2120..2122,2162..2164)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 2225..2335
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(2225..2227,2234..2236,2276..2278)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 2339..2449
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(2339..2341,2348..2350,2390..2392)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 2453..2563
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(2453..2455,2462..2464,2504..2506)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 2567..2677
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(2567..2569,2576..2578,2618..2620)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 2681..2791
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(2681..2683,2690..2692,2732..2734)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 2795..2905
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(2795..2797,2804..2806,2846..2848)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 2909..3019
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(2909..2911,2918..2920,2960..2962)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 3023..3133
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(3023..3025,3032..3034,3074..3076)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 3137..3247
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(3137..3139,3146..3148,3188..3190)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 3251..3361
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(3251..3253,3260..3262,3302..3304)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 3365..3475
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(3365..3367,3374..3376,3416..3418)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 3482..3871
/gene="LOC118413867"
/note="C-type lectin (CTL) or carbohydrate-recognition
domain (CRD); Region: CLECT; smart00034"
/db_xref="CDD:214480"
misc_feature order(3782..3784,3794..3796,3800..3802,3818..3820,
3824..3835,3842..3847,3854..3856)
/gene="LOC118413867"
/note="ligand binding surface [chemical binding]; other
site"
/db_xref="CDD:153057"
ORIGIN
ctacaccgcacgcggcccagggatacccgcagacatgtctgtacagggaggctcgtggctgcttctgacgggcctggcgttgttcttctcctactctgcagccgtgtgcccactaccaaactacacaccgaccagcatcgacgggtactgctaccgggagaaagtggggatgtttgacttccatgcggccgagcacatttgtgaagaggacggtgctctcctcataacggataaaaacatatacagacatatgtggctccagttgaaagacttcgctcagggattctggctcggattggaggacgaagaggttccaggagagtactactggagtgacaatgaaactttgtccgagccgacattttgggaacctacaattcccgacgacccctcaaagcactgcgtcatctctgttcgaaatgggaccggaggagtcaccgcacagtcgaactgggtgcctgcggactgccacagctactacaccaacgtcgtctgtgaagttgataacgatgaatgtgcatcgaacacagagaacgcctgcaacgaacccaacatgcactgcgtgaacaccatcggctggtacgagtgtgagtgcgatgcagggtaccactgggagggcaacatatgtgccgaggagcacatcggcccgactgaagccccgatacacgatgaatgccccgtgggctgggacgacaccttcacgggcatgtgcatcaaggcgtttaccgtaaagtccaactggcccatggcgcattttacgtgcggcacgtcggagagggggcggctggtgaccatcgaagaccaggaaaagttagatttcatgaaaacttacgccgatgctcctaactactattggatcggattgaacgatgtgatggaggagggaacacttgtgtggacagacggggacgacctggaccctgccgagtttacccccgccgtcccgtggtcttcagaccccaattaccagaacacagacgccattgactgcgtctgcttcgccaaaggcatactcaatggcgtgtacaacacgtgggctttcgagtcatgtttaacgaagaaaaaattcatctgcgagatcgatctggacgagtgcagtgctaagccatgtctcaacaacggcacttgttacgaggagcaccctgtagggttcggctgcacatgcgaaccaggctacgaaggagatatctgcgagatagatgtagacgaatgcgctaacgtgacctgtgagaacggcggaacctgcgtcgacggcatcaacgaatactcctgcgattgtcctattggcattgaaggcactcactgcgaaataaatatagacgattgtcctggcgtgacctgtcagaacggcggaacctgcgtcgatggcatcaacgactactcctgcgactgtgttgatggctatgaaggcgagcactgtgaaacagagacagacgagtgtgatcccgatccgtgccagaacggcggaacctgtacggactcacttaatgccttcgactgctcgtgcacgcctggatgggagggggatacatgtgaaacaaatacggacgactgcgttggagtgaattgtcaaaatggcggaacctgcgtcgacgaagtggacggttactcctgcacttgtgctcctggctatgaaggtgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgaattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgttggagtggattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgttcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtccaaatggcgggacctgcgtcgacgaagtggacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatggcgggacctgcgtcgacgaagtggacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgaattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgttggagtggattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgttcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatggcgggacctgcgtcgacgaagtggacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgaattgtcaaaatggcgggacctgcgtcgacgatgttaacggttactcctgcacatgtgctcctggctatcaaggcgatcactgtgaaacagatacggatgactgccttggagtgaattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgttggagtggattgtcaaaatggcggaacctgcgtcgacgaagtggacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatggcggaacctgcgtcgacgaagttgacggttactcctgcacttgtgttcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgaattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgttggagtgaattgtcaaaatggcggaacctgcgtcgacgaagttgacggttactcctgcacttgtgcacctggctatgaaggcgatcattgtgaaacagacacggacgaatgtagctccgagccctgtctaaacggtggaacttgcgaggatgacatcagtggctacacctgcacgtgtgctcttaactatgaaggagatcattgtgaaaccggttgtgaggccggttactggttatacaacggcagatgctactggttctctgacttctggcgcgaatacagcgacgcggaggacgcatgcgccacaagaggttcccttctggcgacggtgaaggatgccgggacgcacggcttcctttcaacgcagatccaagccacccaagatggaaggagccactggatcgggctgactgaccgagtaacggacggggagtacgtctggagtgacgggacctcgctcgggtcttaccaaccctggaggacaggggagttcgggttcggcgaccacacccggaaaggttgcgtcatgctgtggcacaccaggaacttcagctgggccaccacgcagtgtgagcataggtggaacctctacttcatctgcgagaaggctgctgtgacaacgactccatagccatcgcggcttcgacagaactaaacgttaccatgacaactgacttggatctgacggtttttttcgactaaagaacccaaggtttaactgagaacaaagatgcccaatatcaactctgttcatatttatagatagatcttaacagtcttattgctcataaacgctaatgtatactattagatatttctctaaatgccacagttgctgctttgattgtttgcccttgtgtcacacataccagcacctgcaatgcgtcatattttttcaacatctgtagtggcaagaccattcttaagaggacgattgattaaaaagaaaataactcccaaccacgggaactttgaacgtactatggtcccaactatggttaactatggtcccaactatggtcccaactatggtcccaactatggtcccaactatggtcccaactatggtcccaactatggttccaactatggtcccaactatggtcccgactgtgatcctaactatggtcc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]