GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-19 21:16:36, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_035817460            4623 bp    mRNA    linear   INV 13-AUG-2020
DEFINITION  PREDICTED: Branchiostoma floridae fibropellin-1-like
            (LOC118413867), transcript variant X4, mRNA.
ACCESSION   XM_035817460
VERSION     XM_035817460.1
DBLINK      BioProject: PRJNA33245
KEYWORDS    RefSeq.
SOURCE      Branchiostoma floridae (Florida lancelet)
  ORGANISM  Branchiostoma floridae
            Eukaryota; Metazoa; Chordata; Cephalochordata; Leptocardii;
            Amphioxiformes; Branchiostomatidae; Branchiostoma.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_049982.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Branchiostoma floridae Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4623
                     /organism="Branchiostoma floridae"
                     /mol_type="mRNA"
                     /strain="S238N-H82"
                     /db_xref="taxon:7739"
                     /chromosome="4"
                     /sex="male"
                     /tissue_type="testes"
                     /country="USA: Old Tampa Bay, Florida"
     gene            1..4623
                     /gene="LOC118413867"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 2 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:118413867"
     CDS             33..4124
                     /gene="LOC118413867"
                     /codon_start=1
                     /product="fibropellin-1-like isoform X4"
                     /protein_id="XP_035673353.1"
                     /db_xref="GeneID:118413867"
                     /translation="
MSVQGGSWLLLTGLALFFSYSAAVCPLPNYTPTSIDGYCYREKVGMFDFHAAEHICEEDGALLITDKNIYRHMWLQLKDFAQGFWLGLEDEEVPGEYYWSDNETLSEPTFWEPTIPDDPSKHCVISVRNGTGGVTAQSNWVPADCHSYYTNVVCEVDNDECASNTENACNEPNMHCVNTIGWYECECDAGYHWEGNICAEEHIGPTEAPIHDECPVGWDDTFTGMCIKAFTVKSNWPMAHFTCGTSERGRLVTIEDQEKLDFMKTYADAPNYYWIGLNDVMEEGTLVWTDGDDLDPAEFTPAVPWSSDPNYQNTDAIDCVCFAKGILNGVYNTWAFESCLTKKKFICEIDLDECSAKPCLNNGTCYEEHPVGFGCTCEPGYEGDICEIDVDECANVTCENGGTCVDGINEYSCDCPIGIEGTHCEINIDDCPGVTCQNGGTCVDGINDYSCDCVDGYEGEHCETETDECDPDPCQNGGTCTDSLNAFDCSCTPGWEGDTCETNTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVDCQNGGTCVDEVDGYSCTCVPGYEGDHCETDTDDCVGVTCPNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVDCQNGGTCVDEVDGYSCTCVPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDDVNGYSCTCAPGYQGDHCETDTDDCLGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVDCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCVPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDECSSEPCLNGGTCEDDISGYTCTCALNYEGDHCETGCEAGYWLYNGRCYWFSDFWREYSDAEDACATRGSLLATVKDAGTHGFLSTQIQATQDGRSHWIGLTDRVTDGEYVWSDGTSLGSYQPWRTGEFGFGDHTRKGCVMLWHTRNFSWATTQCEHRWNLYFICEKAAVTTTP"
     misc_feature    144..500
                     /gene="LOC118413867"
                     /note="C-type lectin (CTL)/C-type lectin-like (CTLD)
                     domain; Region: CLECT; cd00037"
                     /db_xref="CDD:153057"
     misc_feature    order(393..395,405..407,411..413,429..431,453..464,
                     471..479)
                     /gene="LOC118413867"
                     /note="ligand binding surface [chemical binding]; other
                     site"
                     /db_xref="CDD:153057"
     misc_feature    672..1076
                     /gene="LOC118413867"
                     /note="C-type lectin (CTL) or carbohydrate-recognition
                     domain (CRD); Region: CLECT; smart00034"
                     /db_xref="CDD:214480"
     misc_feature    order(975..977,1005..1007,1011..1013,1029..1031,
                     1035..1046,1053..1061)
                     /gene="LOC118413867"
                     /note="ligand binding surface [chemical binding]; other
                     site"
                     /db_xref="CDD:153057"
     misc_feature    1197..1307
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(1197..1199,1206..1208,1248..1250)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    1311..1421
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(1311..1313,1320..1322,1362..1364)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    1431..1535
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    1539..1649
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(1539..1541,1548..1550,1590..1592)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    1653..1763
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(1653..1655,1662..1664,1704..1706)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    1767..1877
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(1767..1769,1776..1778,1818..1820)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    1881..1991
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(1881..1883,1890..1892,1932..1934)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    1995..2105
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(1995..1997,2004..2006,2046..2048)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    2109..2219
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(2109..2111,2118..2120,2160..2162)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    2223..2333
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(2223..2225,2232..2234,2274..2276)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    2337..2447
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(2337..2339,2346..2348,2388..2390)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    2451..2561
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(2451..2453,2460..2462,2502..2504)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    2565..2675
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(2565..2567,2574..2576,2616..2618)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    2679..2789
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(2679..2681,2688..2690,2730..2732)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    2793..2903
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(2793..2795,2802..2804,2844..2846)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    2907..3017
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(2907..2909,2916..2918,2958..2960)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    3021..3131
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(3021..3023,3030..3032,3072..3074)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    3135..3245
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(3135..3137,3144..3146,3186..3188)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    3249..3359
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(3249..3251,3258..3260,3300..3302)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    3363..3473
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(3363..3365,3372..3374,3414..3416)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    3477..3587
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(3477..3479,3486..3488,3528..3530)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    3591..3701
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(3591..3593,3600..3602,3642..3644)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    3708..4097
                     /gene="LOC118413867"
                     /note="C-type lectin (CTL) or carbohydrate-recognition
                     domain (CRD); Region: CLECT; smart00034"
                     /db_xref="CDD:214480"
     misc_feature    order(4008..4010,4020..4022,4026..4028,4044..4046,
                     4050..4061,4068..4073,4080..4082)
                     /gene="LOC118413867"
                     /note="ligand binding surface [chemical binding]; other
                     site"
                     /db_xref="CDD:153057"
ORIGIN      
acaccgcacgcggcccagggatacccgcagacatgtctgtacagggaggctcgtggctgcttctgacgggcctggcgttgttcttctcctactctgcagccgtgtgcccactaccaaactacacaccgaccagcatcgacgggtactgctaccgggagaaagtggggatgtttgacttccatgcggccgagcacatttgtgaagaggacggtgctctcctcataacggataaaaacatatacagacatatgtggctccagttgaaagacttcgctcagggattctggctcggattggaggacgaagaggttccaggagagtactactggagtgacaatgaaactttgtccgagccgacattttgggaacctacaattcccgacgacccctcaaagcactgcgtcatctctgttcgaaatgggaccggaggagtcaccgcacagtcgaactgggtgcctgcggactgccacagctactacaccaacgtcgtctgtgaagttgataacgatgaatgtgcatcgaacacagagaacgcctgcaacgaacccaacatgcactgcgtgaacaccatcggctggtacgagtgtgagtgcgatgcagggtaccactgggagggcaacatatgtgccgaggagcacatcggcccgactgaagccccgatacacgatgaatgccccgtgggctgggacgacaccttcacgggcatgtgcatcaaggcgtttaccgtaaagtccaactggcccatggcgcattttacgtgcggcacgtcggagagggggcggctggtgaccatcgaagaccaggaaaagttagatttcatgaaaacttacgccgatgctcctaactactattggatcggattgaacgatgtgatggaggagggaacacttgtgtggacagacggggacgacctggaccctgccgagtttacccccgccgtcccgtggtcttcagaccccaattaccagaacacagacgccattgactgcgtctgcttcgccaaaggcatactcaatggcgtgtacaacacgtgggctttcgagtcatgtttaacgaagaaaaaattcatctgcgagatcgatctggacgagtgcagtgctaagccatgtctcaacaacggcacttgttacgaggagcaccctgtagggttcggctgcacatgcgaaccaggctacgaaggagatatctgcgagatagatgtagacgaatgcgctaacgtgacctgtgagaacggcggaacctgcgtcgacggcatcaacgaatactcctgcgattgtcctattggcattgaaggcactcactgcgaaataaatatagacgattgtcctggcgtgacctgtcagaacggcggaacctgcgtcgatggcatcaacgactactcctgcgactgtgttgatggctatgaaggcgagcactgtgaaacagagacagacgagtgtgatcccgatccgtgccagaacggcggaacctgtacggactcacttaatgccttcgactgctcgtgcacgcctggatgggagggggatacatgtgaaacaaatacggacgactgcgttggagtgaattgtcaaaatggcggaacctgcgtcgacgaagtggacggttactcctgcacttgtgctcctggctatgaaggtgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgaattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgttggagtggattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgttcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtccaaatggcgggacctgcgtcgacgaagtggacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatggcgggacctgcgtcgacgaagtggacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgaattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgttggagtggattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgttcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatggcgggacctgcgtcgacgaagtggacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgaattgtcaaaatggcgggacctgcgtcgacgatgttaacggttactcctgcacatgtgctcctggctatcaaggcgatcactgtgaaacagatacggatgactgccttggagtgaattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgttggagtggattgtcaaaatggcggaacctgcgtcgacgaagtggacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatggcggaacctgcgtcgacgaagttgacggttactcctgcacttgtgttcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatgggggaacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgttggagtgaattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgaattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgttggagtgaattgtcaaaatggcggaacctgcgtcgacgaagttgacggttactcctgcacttgtgcacctggctatgaaggcgatcattgtgaaacagacacggacgaatgtagctccgagccctgtctaaacggtggaacttgcgaggatgacatcagtggctacacctgcacgtgtgctcttaactatgaaggagatcattgtgaaaccggttgtgaggccggttactggttatacaacggcagatgctactggttctctgacttctggcgcgaatacagcgacgcggaggacgcatgcgccacaagaggttcccttctggcgacggtgaaggatgccgggacgcacggcttcctttcaacgcagatccaagccacccaagatggaaggagccactggatcgggctgactgaccgagtaacggacggggagtacgtctggagtgacgggacctcgctcgggtcttaccaaccctggaggacaggggagttcgggttcggcgaccacacccggaaaggttgcgtcatgctgtggcacaccaggaacttcagctgggccaccacgcagtgtgagcataggtggaacctctacttcatctgcgagaaggctgctgtgacaacgactccatagccatcgcggcttcgacagaactaaacgttaccatgacaactgacttggatctgacggtttttttcgactaaagaacccaaggtttaactgagaacaaagatgcccaatatcaactctgttcatatttatagatagatcttaacagtcttattgctcataaacgctaatgtatactattagatatttctctaaatgccacagttgctgctttgattgtttgcccttgtgtcacacataccagcacctgcaatgcgtcatattttttcaacatctgtagtggcaagaccattcttaagaggacgattgattaaaaagaaaataactcccaaccacgggaactttgaacgtactatggtcccaactatggttaactatggtcccaactatggtcccaactatggtcccaactatggtcccaactatggtcccaactatggtcccaactatggttccaactatggtcccaactatggtcccgactgtgatcctaactatggtc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]