ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2024-04-19 15:49:59, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_035817459 4737 bp mRNA linear INV 13-AUG-2020
DEFINITION PREDICTED: Branchiostoma floridae fibropellin-1-like
(LOC118413867), transcript variant X3, mRNA.
ACCESSION XM_035817459
VERSION XM_035817459.1
DBLINK BioProject: PRJNA33245
KEYWORDS RefSeq.
SOURCE Branchiostoma floridae (Florida lancelet)
ORGANISM Branchiostoma floridae
Eukaryota; Metazoa; Chordata; Cephalochordata; Leptocardii;
Amphioxiformes; Branchiostomatidae; Branchiostoma.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NC_049982.1) annotated using gene prediction method: Gnomon.
Also see:
Documentation of NCBI's Annotation Process
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI
Annotation Status :: Full annotation
Annotation Name :: Branchiostoma floridae Annotation
Release 100
Annotation Version :: 100
Annotation Pipeline :: NCBI eukaryotic genome annotation
pipeline
Annotation Software Version :: 8.5
Annotation Method :: Best-placed RefSeq; Gnomon
Features Annotated :: Gene; mRNA; CDS; ncRNA
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..4737
/organism="Branchiostoma floridae"
/mol_type="mRNA"
/strain="S238N-H82"
/db_xref="taxon:7739"
/chromosome="4"
/sex="male"
/tissue_type="testes"
/country="USA: Old Tampa Bay, Florida"
gene 1..4737
/gene="LOC118413867"
/note="Derived by automated computational analysis using
gene prediction method: Gnomon. Supporting evidence
includes similarity to: 100% coverage of the annotated
genomic feature by RNAseq alignments, including 2 samples
with support for all annotated introns"
/db_xref="GeneID:118413867"
CDS 33..4238
/gene="LOC118413867"
/codon_start=1
/product="fibropellin-1-like isoform X3"
/protein_id="XP_035673352.1"
/db_xref="GeneID:118413867"
/translation="
MSVQGGSWLLLTGLALFFSYSAAVCPLPNYTPTSIDGYCYREKVGMFDFHAAEHICEEDGALLITDKNIYRHMWLQLKDFAQGFWLGLEDEEVPGEYYWSDNETLSEPTFWEPTIPDDPSKHCVISVRNGTGGVTAQSNWVPADCHSYYTNVVCEVDNDECASNTENACNEPNMHCVNTIGWYECECDAGYHWEGNICAEEHIGPTEAPIHDECPVGWDDTFTGMCIKAFTVKSNWPMAHFTCGTSERGRLVTIEDQEKLDFMKTYADAPNYYWIGLNDVMEEGTLVWTDGDDLDPAEFTPAVPWSSDPNYQNTDAIDCVCFAKGILNGVYNTWAFESCLTKKKFICEIDLDECSAKPCLNNGTCYEEHPVGFGCTCEPGYEGDICEIDVDECANVTCENGGTCVDGINEYSCDCPIGIEGTHCEINIDDCPGVTCQNGGTCVDGINDYSCDCVDGYEGEHCETETDECDPDPCQNGGTCTDSLNAFDCSCTPGWEGDTCETNTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVDCQNGGTCVDEVDGYSCTCVPGYEGDHCETDTDDCVGVTCPNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVDCQNGGTCVDEVDGYSCTCVPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDDVNGYSCTCAPGYQGDHCETDTDDCLGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVDCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCVPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVDCQNGGTCFDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDECSSEPCLNGGTCEDDISGYTCTCALNYEGDHCETGCEAGYWLYNGRCYWFSDFWREYSDAEDACATRGSLLATVKDAGTHGFLSTQIQATQDGRSHWIGLTDRVTDGEYVWSDGTSLGSYQPWRTGEFGFGDHTRKGCVMLWHTRNFSWATTQCEHRWNLYFICEKAAVTTTP"
misc_feature 144..500
/gene="LOC118413867"
/note="C-type lectin (CTL)/C-type lectin-like (CTLD)
domain; Region: CLECT; cd00037"
/db_xref="CDD:153057"
misc_feature order(393..395,405..407,411..413,429..431,453..464,
471..479)
/gene="LOC118413867"
/note="ligand binding surface [chemical binding]; other
site"
/db_xref="CDD:153057"
misc_feature 672..1076
/gene="LOC118413867"
/note="C-type lectin (CTL) or carbohydrate-recognition
domain (CRD); Region: CLECT; smart00034"
/db_xref="CDD:214480"
misc_feature order(975..977,1005..1007,1011..1013,1029..1031,
1035..1046,1053..1061)
/gene="LOC118413867"
/note="ligand binding surface [chemical binding]; other
site"
/db_xref="CDD:153057"
misc_feature 1197..1307
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(1197..1199,1206..1208,1248..1250)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 1311..1421
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(1311..1313,1320..1322,1362..1364)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 1431..1535
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature 1539..1649
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(1539..1541,1548..1550,1590..1592)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 1653..1763
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(1653..1655,1662..1664,1704..1706)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 1767..1877
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(1767..1769,1776..1778,1818..1820)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 1881..1991
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(1881..1883,1890..1892,1932..1934)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 1995..2105
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(1995..1997,2004..2006,2046..2048)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 2109..2219
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(2109..2111,2118..2120,2160..2162)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 2223..2333
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(2223..2225,2232..2234,2274..2276)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 2337..2447
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(2337..2339,2346..2348,2388..2390)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 2451..2561
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(2451..2453,2460..2462,2502..2504)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 2565..2675
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(2565..2567,2574..2576,2616..2618)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 2679..2789
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(2679..2681,2688..2690,2730..2732)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 2793..2903
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(2793..2795,2802..2804,2844..2846)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 2907..3017
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(2907..2909,2916..2918,2958..2960)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 3021..3131
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(3021..3023,3030..3032,3072..3074)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 3135..3245
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(3135..3137,3144..3146,3186..3188)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 3249..3359
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(3249..3251,3258..3260,3300..3302)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 3363..3473
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(3363..3365,3372..3374,3414..3416)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 3477..3587
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(3477..3479,3486..3488,3528..3530)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 3591..3701
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(3591..3593,3600..3602,3642..3644)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 3705..3815
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(3705..3707,3714..3716,3756..3758)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 3822..4211
/gene="LOC118413867"
/note="C-type lectin (CTL) or carbohydrate-recognition
domain (CRD); Region: CLECT; smart00034"
/db_xref="CDD:214480"
misc_feature order(4122..4124,4134..4136,4140..4142,4158..4160,
4164..4175,4182..4187,4194..4196)
/gene="LOC118413867"
/note="ligand binding surface [chemical binding]; other
site"
/db_xref="CDD:153057"
ORIGIN
acaccgcacgcggcccagggatacccgcagacatgtctgtacagggaggctcgtggctgcttctgacgggcctggcgttgttcttctcctactctgcagccgtgtgcccactaccaaactacacaccgaccagcatcgacgggtactgctaccgggagaaagtggggatgtttgacttccatgcggccgagcacatttgtgaagaggacggtgctctcctcataacggataaaaacatatacagacatatgtggctccagttgaaagacttcgctcagggattctggctcggattggaggacgaagaggttccaggagagtactactggagtgacaatgaaactttgtccgagccgacattttgggaacctacaattcccgacgacccctcaaagcactgcgtcatctctgttcgaaatgggaccggaggagtcaccgcacagtcgaactgggtgcctgcggactgccacagctactacaccaacgtcgtctgtgaagttgataacgatgaatgtgcatcgaacacagagaacgcctgcaacgaacccaacatgcactgcgtgaacaccatcggctggtacgagtgtgagtgcgatgcagggtaccactgggagggcaacatatgtgccgaggagcacatcggcccgactgaagccccgatacacgatgaatgccccgtgggctgggacgacaccttcacgggcatgtgcatcaaggcgtttaccgtaaagtccaactggcccatggcgcattttacgtgcggcacgtcggagagggggcggctggtgaccatcgaagaccaggaaaagttagatttcatgaaaacttacgccgatgctcctaactactattggatcggattgaacgatgtgatggaggagggaacacttgtgtggacagacggggacgacctggaccctgccgagtttacccccgccgtcccgtggtcttcagaccccaattaccagaacacagacgccattgactgcgtctgcttcgccaaaggcatactcaatggcgtgtacaacacgtgggctttcgagtcatgtttaacgaagaaaaaattcatctgcgagatcgatctggacgagtgcagtgctaagccatgtctcaacaacggcacttgttacgaggagcaccctgtagggttcggctgcacatgcgaaccaggctacgaaggagatatctgcgagatagatgtagacgaatgcgctaacgtgacctgtgagaacggcggaacctgcgtcgacggcatcaacgaatactcctgcgattgtcctattggcattgaaggcactcactgcgaaataaatatagacgattgtcctggcgtgacctgtcagaacggcggaacctgcgtcgatggcatcaacgactactcctgcgactgtgttgatggctatgaaggcgagcactgtgaaacagagacagacgagtgtgatcccgatccgtgccagaacggcggaacctgtacggactcacttaatgccttcgactgctcgtgcacgcctggatgggagggggatacatgtgaaacaaatacggacgactgcgttggagtgaattgtcaaaatggcggaacctgcgtcgacgaagtggacggttactcctgcacttgtgctcctggctatgaaggtgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgaattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgttggagtggattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgttcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtccaaatggcgggacctgcgtcgacgaagtggacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatggcgggacctgcgtcgacgaagtggacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgaattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgttggagtggattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgttcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatggcgggacctgcgtcgacgaagtggacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgaattgtcaaaatggcgggacctgcgtcgacgatgttaacggttactcctgcacatgtgctcctggctatcaaggcgatcactgtgaaacagatacggatgactgccttggagtgaattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgttggagtggattgtcaaaatggcggaacctgcgtcgacgaagtggacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatggcggaacctgcgtcgacgaagttgacggttactcctgcacttgtgttcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatgggggaacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgttggagtgaattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgaattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgtaggagtggattgtcaaaatggcgggacctgcttcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgttggagtgaattgtcaaaatggcggaacctgcgtcgacgaagttgacggttactcctgcacttgtgcacctggctatgaaggcgatcattgtgaaacagacacggacgaatgtagctccgagccctgtctaaacggtggaacttgcgaggatgacatcagtggctacacctgcacgtgtgctcttaactatgaaggagatcattgtgaaaccggttgtgaggccggttactggttatacaacggcagatgctactggttctctgacttctggcgcgaatacagcgacgcggaggacgcatgcgccacaagaggttcccttctggcgacggtgaaggatgccgggacgcacggcttcctttcaacgcagatccaagccacccaagatggaaggagccactggatcgggctgactgaccgagtaacggacggggagtacgtctggagtgacgggacctcgctcgggtcttaccaaccctggaggacaggggagttcgggttcggcgaccacacccggaaaggttgcgtcatgctgtggcacaccaggaacttcagctgggccaccacgcagtgtgagcataggtggaacctctacttcatctgcgagaaggctgctgtgacaacgactccatagccatcgcggcttcgacagaactaaacgttaccatgacaactgacttggatctgacggtttttttcgactaaagaacccaaggtttaactgagaacaaagatgcccaatatcaactctgttcatatttatagatagatcttaacagtcttattgctcataaacgctaatgtatactattagatatttctctaaatgccacagttgctgctttgattgtttgcccttgtgtcacacataccagcacctgcaatgcgtcatattttttcaacatctgtagtggcaagaccattcttaagaggacgattgattaaaaagaaaataactcccaaccacgggaactttgaacgtactatggtcccaactatggttaactatggtcccaactatggtcccaactatggtcccaactatggtcccaactatggtcccaactatggtcccaactatggttccaactatggtcccaactatggtcccgactgtgatcctaactatggtc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]