ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2024-04-25 06:38:52, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_035817458 4852 bp mRNA linear INV 13-AUG-2020
DEFINITION PREDICTED: Branchiostoma floridae fibropellin-1-like
(LOC118413867), transcript variant X2, mRNA.
ACCESSION XM_035817458
VERSION XM_035817458.1
DBLINK BioProject: PRJNA33245
KEYWORDS RefSeq.
SOURCE Branchiostoma floridae (Florida lancelet)
ORGANISM Branchiostoma floridae
Eukaryota; Metazoa; Chordata; Cephalochordata; Leptocardii;
Amphioxiformes; Branchiostomatidae; Branchiostoma.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NC_049982.1) annotated using gene prediction method: Gnomon.
Also see:
Documentation of NCBI's Annotation Process
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI
Annotation Status :: Full annotation
Annotation Name :: Branchiostoma floridae Annotation
Release 100
Annotation Version :: 100
Annotation Pipeline :: NCBI eukaryotic genome annotation
pipeline
Annotation Software Version :: 8.5
Annotation Method :: Best-placed RefSeq; Gnomon
Features Annotated :: Gene; mRNA; CDS; ncRNA
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..4852
/organism="Branchiostoma floridae"
/mol_type="mRNA"
/strain="S238N-H82"
/db_xref="taxon:7739"
/chromosome="4"
/sex="male"
/tissue_type="testes"
/country="USA: Old Tampa Bay, Florida"
gene 1..4852
/gene="LOC118413867"
/note="Derived by automated computational analysis using
gene prediction method: Gnomon. Supporting evidence
includes similarity to: 100% coverage of the annotated
genomic feature by RNAseq alignments, including 2 samples
with support for all annotated introns"
/db_xref="GeneID:118413867"
CDS 34..4353
/gene="LOC118413867"
/codon_start=1
/product="fibropellin-1-like isoform X2"
/protein_id="XP_035673351.1"
/db_xref="GeneID:118413867"
/translation="
MSVQGGSWLLLTGLALFFSYSAAVCPLPNYTPTSIDGYCYREKVGMFDFHAAEHICEEDGALLITDKNIYRHMWLQLKDFAQGFWLGLEDEEVPGEYYWSDNETLSEPTFWEPTIPDDPSKHCVISVRNGTGGVTAQSNWVPADCHSYYTNVVCEVDNDECASNTENACNEPNMHCVNTIGWYECECDAGYHWEGNICAEEHIGPTEAPIHDECPVGWDDTFTGMCIKAFTVKSNWPMAHFTCGTSERGRLVTIEDQEKLDFMKTYADAPNYYWIGLNDVMEEGTLVWTDGDDLDPAEFTPAVPWSSDPNYQNTDAIDCVCFAKGILNGVYNTWAFESCLTKKKFICEIDLDECSAKPCLNNGTCYEEHPVGFGCTCEPGYEGDICEIDVDECANVTCENGGTCVDGINEYSCDCPIGIEGTHCEINIDDCPGVTCQNGGTCVDGINDYSCDCVDGYEGEHCETETDECDPDPCQNGGTCTDSLNAFDCSCTPGWEGDTCETNTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVDCQNGGTCVDEVDGYSCTCVPGYEGDHCETDTDDCVGVTCPNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVDCQNGGTCVDEVDGYSCTCVPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDDVNGYSCTCAPGYQGDHCETDTDDCLGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVDCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCVPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVDCQNGGTCFDEVDGYSCTCAPGYEGDHCETDTDGCVGVDCQNGGTCVDEVDGYSCTCDPGYEGDHCETDTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDECSSEPCLNGGTCEDDISGYTCTCALNYEGDHCETGCEAGYWLYNGRCYWFSDFWREYSDAEDACATRGSLLATVKDAGTHGFLSTQIQATQDGRSHWIGLTDRVTDGEYVWSDGTSLGSYQPWRTGEFGFGDHTRKGCVMLWHTRNFSWATTQCEHRWNLYFICEKAAVTTTP"
misc_feature 145..501
/gene="LOC118413867"
/note="C-type lectin (CTL)/C-type lectin-like (CTLD)
domain; Region: CLECT; cd00037"
/db_xref="CDD:153057"
misc_feature order(394..396,406..408,412..414,430..432,454..465,
472..480)
/gene="LOC118413867"
/note="ligand binding surface [chemical binding]; other
site"
/db_xref="CDD:153057"
misc_feature 673..1077
/gene="LOC118413867"
/note="C-type lectin (CTL) or carbohydrate-recognition
domain (CRD); Region: CLECT; smart00034"
/db_xref="CDD:214480"
misc_feature order(976..978,1006..1008,1012..1014,1030..1032,
1036..1047,1054..1062)
/gene="LOC118413867"
/note="ligand binding surface [chemical binding]; other
site"
/db_xref="CDD:153057"
misc_feature 1198..1308
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(1198..1200,1207..1209,1249..1251)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 1312..1422
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(1312..1314,1321..1323,1363..1365)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 1432..1536
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature 1540..1650
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(1540..1542,1549..1551,1591..1593)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 1654..1764
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(1654..1656,1663..1665,1705..1707)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 1768..1878
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(1768..1770,1777..1779,1819..1821)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 1882..1992
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(1882..1884,1891..1893,1933..1935)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 1996..2106
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(1996..1998,2005..2007,2047..2049)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 2110..2220
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(2110..2112,2119..2121,2161..2163)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 2224..2334
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(2224..2226,2233..2235,2275..2277)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 2338..2448
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(2338..2340,2347..2349,2389..2391)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 2452..2562
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(2452..2454,2461..2463,2503..2505)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 2566..2676
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(2566..2568,2575..2577,2617..2619)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 2680..2790
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(2680..2682,2689..2691,2731..2733)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 2794..2904
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(2794..2796,2803..2805,2845..2847)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 2908..3018
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(2908..2910,2917..2919,2959..2961)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 3022..3132
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(3022..3024,3031..3033,3073..3075)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 3136..3246
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(3136..3138,3145..3147,3187..3189)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 3250..3360
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(3250..3252,3259..3261,3301..3303)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 3364..3474
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(3364..3366,3373..3375,3415..3417)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 3478..3588
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(3478..3480,3487..3489,3529..3531)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature <3619..3702
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature 3706..3816
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(3706..3708,3715..3717,3757..3759)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 3820..3930
/gene="LOC118413867"
/note="Calcium-binding EGF-like domain, present in a large
number of membrane-bound and extracellular (mostly animal)
proteins. Many of these proteins require calcium for their
biological function and calcium-binding sites have been
found to be located at the...; Region: EGF_CA; cd00054"
/db_xref="CDD:238011"
misc_feature order(3820..3822,3829..3831,3871..3873)
/gene="LOC118413867"
/note="Ca2+ binding site [ion binding]; other site"
/db_xref="CDD:238011"
misc_feature 3937..4326
/gene="LOC118413867"
/note="C-type lectin (CTL) or carbohydrate-recognition
domain (CRD); Region: CLECT; smart00034"
/db_xref="CDD:214480"
misc_feature order(4237..4239,4249..4251,4255..4257,4273..4275,
4279..4290,4297..4302,4309..4311)
/gene="LOC118413867"
/note="ligand binding surface [chemical binding]; other
site"
/db_xref="CDD:153057"
ORIGIN
tacaccgcacgcggcccagggatacccgcagacatgtctgtacagggaggctcgtggctgcttctgacgggcctggcgttgttcttctcctactctgcagccgtgtgcccactaccaaactacacaccgaccagcatcgacgggtactgctaccgggagaaagtggggatgtttgacttccatgcggccgagcacatttgtgaagaggacggtgctctcctcataacggataaaaacatatacagacatatgtggctccagttgaaagacttcgctcagggattctggctcggattggaggacgaagaggttccaggagagtactactggagtgacaatgaaactttgtccgagccgacattttgggaacctacaattcccgacgacccctcaaagcactgcgtcatctctgttcgaaatgggaccggaggagtcaccgcacagtcgaactgggtgcctgcggactgccacagctactacaccaacgtcgtctgtgaagttgataacgatgaatgtgcatcgaacacagagaacgcctgcaacgaacccaacatgcactgcgtgaacaccatcggctggtacgagtgtgagtgcgatgcagggtaccactgggagggcaacatatgtgccgaggagcacatcggcccgactgaagccccgatacacgatgaatgccccgtgggctgggacgacaccttcacgggcatgtgcatcaaggcgtttaccgtaaagtccaactggcccatggcgcattttacgtgcggcacgtcggagagggggcggctggtgaccatcgaagaccaggaaaagttagatttcatgaaaacttacgccgatgctcctaactactattggatcggattgaacgatgtgatggaggagggaacacttgtgtggacagacggggacgacctggaccctgccgagtttacccccgccgtcccgtggtcttcagaccccaattaccagaacacagacgccattgactgcgtctgcttcgccaaaggcatactcaatggcgtgtacaacacgtgggctttcgagtcatgtttaacgaagaaaaaattcatctgcgagatcgatctggacgagtgcagtgctaagccatgtctcaacaacggcacttgttacgaggagcaccctgtagggttcggctgcacatgcgaaccaggctacgaaggagatatctgcgagatagatgtagacgaatgcgctaacgtgacctgtgagaacggcggaacctgcgtcgacggcatcaacgaatactcctgcgattgtcctattggcattgaaggcactcactgcgaaataaatatagacgattgtcctggcgtgacctgtcagaacggcggaacctgcgtcgatggcatcaacgactactcctgcgactgtgttgatggctatgaaggcgagcactgtgaaacagagacagacgagtgtgatcccgatccgtgccagaacggcggaacctgtacggactcacttaatgccttcgactgctcgtgcacgcctggatgggagggggatacatgtgaaacaaatacggacgactgcgttggagtgaattgtcaaaatggcggaacctgcgtcgacgaagtggacggttactcctgcacttgtgctcctggctatgaaggtgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgaattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgttggagtggattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgttcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtccaaatggcgggacctgcgtcgacgaagtggacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatggcgggacctgcgtcgacgaagtggacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgaattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgttggagtggattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgttcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatggcgggacctgcgtcgacgaagtggacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgaattgtcaaaatggcgggacctgcgtcgacgatgttaacggttactcctgcacatgtgctcctggctatcaaggcgatcactgtgaaacagatacggatgactgccttggagtgaattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgttggagtggattgtcaaaatggcggaacctgcgtcgacgaagtggacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatggcggaacctgcgtcgacgaagttgacggttactcctgcacttgtgttcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatgggggaacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgttggagtgaattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgaattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgtaggagtggattgtcaaaatggcgggacctgcttcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatggctgcgttggagtggattgtcaaaatggcgggacctgcgttgacgaagttgacggttactcctgcacttgtgatcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgttggagtgaattgtcaaaatggcggaacctgcgtcgacgaagttgacggttactcctgcacttgtgcacctggctatgaaggcgatcattgtgaaacagacacggacgaatgtagctccgagccctgtctaaacggtggaacttgcgaggatgacatcagtggctacacctgcacgtgtgctcttaactatgaaggagatcattgtgaaaccggttgtgaggccggttactggttatacaacggcagatgctactggttctctgacttctggcgcgaatacagcgacgcggaggacgcatgcgccacaagaggttcccttctggcgacggtgaaggatgccgggacgcacggcttcctttcaacgcagatccaagccacccaagatggaaggagccactggatcgggctgactgaccgagtaacggacggggagtacgtctggagtgacgggacctcgctcgggtcttaccaaccctggaggacaggggagttcgggttcggcgaccacacccggaaaggttgcgtcatgctgtggcacaccaggaacttcagctgggccaccacgcagtgtgagcataggtggaacctctacttcatctgcgagaaggctgctgtgacaacgactccatagccatcgcggcttcgacagaactaaacgttaccatgacaactgacttggatctgacggtttttttcgactaaagaacccaaggtttaactgagaacaaagatgcccaatatcaactctgttcatatttatagatagatcttaacagtcttattgctcataaacgctaatgtatactattagatatttctctaaatgccacagttgctgctttgattgtttgcccttgtgtcacacataccagcacctgcaatgcgtcatattttttcaacatctgtagtggcaagaccattcttaagaggacgattgattaaaaagaaaataactcccaaccacgggaactttgaacgtactatggtcccaactatggttaactatggtcccaactatggtcccaactatggtcccaactatggtcccaactatggtcccaactatggtcccaactatggttccaactatggtcccaactatggtcccgactgtgatcctaactatggtc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]