GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-26 06:51:11, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_035817457            4966 bp    mRNA    linear   INV 13-AUG-2020
DEFINITION  PREDICTED: Branchiostoma floridae fibropellin-1-like
            (LOC118413867), transcript variant X1, mRNA.
ACCESSION   XM_035817457
VERSION     XM_035817457.1
DBLINK      BioProject: PRJNA33245
KEYWORDS    RefSeq.
SOURCE      Branchiostoma floridae (Florida lancelet)
  ORGANISM  Branchiostoma floridae
            Eukaryota; Metazoa; Chordata; Cephalochordata; Leptocardii;
            Amphioxiformes; Branchiostomatidae; Branchiostoma.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_049982.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Branchiostoma floridae Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4966
                     /organism="Branchiostoma floridae"
                     /mol_type="mRNA"
                     /strain="S238N-H82"
                     /db_xref="taxon:7739"
                     /chromosome="4"
                     /sex="male"
                     /tissue_type="testes"
                     /country="USA: Old Tampa Bay, Florida"
     gene            1..4966
                     /gene="LOC118413867"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments"
                     /db_xref="GeneID:118413867"
     CDS             34..4467
                     /gene="LOC118413867"
                     /codon_start=1
                     /product="fibropellin-1-like isoform X1"
                     /protein_id="XP_035673350.1"
                     /db_xref="GeneID:118413867"
                     /translation="
MSVQGGSWLLLTGLALFFSYSAAVCPLPNYTPTSIDGYCYREKVGMFDFHAAEHICEEDGALLITDKNIYRHMWLQLKDFAQGFWLGLEDEEVPGEYYWSDNETLSEPTFWEPTIPDDPSKHCVISVRNGTGGVTAQSNWVPADCHSYYTNVVCEVDNDECASNTENACNEPNMHCVNTIGWYECECDAGYHWEGNICAEEHIGPTEAPIHDECPVGWDDTFTGMCIKAFTVKSNWPMAHFTCGTSERGRLVTIEDQEKLDFMKTYADAPNYYWIGLNDVMEEGTLVWTDGDDLDPAEFTPAVPWSSDPNYQNTDAIDCVCFAKGILNGVYNTWAFESCLTKKKFICEIDLDECSAKPCLNNGTCYEEHPVGFGCTCEPGYEGDICEIDVDECANVTCENGGTCVDGINEYSCDCPIGIEGTHCEINIDDCPGVTCQNGGTCVDGINDYSCDCVDGYEGEHCETETDECDPDPCQNGGTCTDSLNAFDCSCTPGWEGDTCETNTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVDCQNGGTCVDEVDGYSCTCVPGYEGDHCETDTDDCVGVTCPNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVDCQNGGTCVDEVDGYSCTCVPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDDVNGYSCTCAPGYQGDHCETDTDDCLGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVDCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCVPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVDCQNGGTCFDEVDGYSCTCAPGYEGDHCETDTDGCVGVDCQNGGTCVDEVDGYSCTCDPGYEGDHCETDREDCVGVDCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDECSSEPCLNGGTCEDDISGYTCTCALNYEGDHCETGCEAGYWLYNGRCYWFSDFWREYSDAEDACATRGSLLATVKDAGTHGFLSTQIQATQDGRSHWIGLTDRVTDGEYVWSDGTSLGSYQPWRTGEFGFGDHTRKGCVMLWHTRNFSWATTQCEHRWNLYFICEKAAVTTTP"
     misc_feature    145..501
                     /gene="LOC118413867"
                     /note="C-type lectin (CTL)/C-type lectin-like (CTLD)
                     domain; Region: CLECT; cd00037"
                     /db_xref="CDD:153057"
     misc_feature    order(394..396,406..408,412..414,430..432,454..465,
                     472..480)
                     /gene="LOC118413867"
                     /note="ligand binding surface [chemical binding]; other
                     site"
                     /db_xref="CDD:153057"
     misc_feature    673..1077
                     /gene="LOC118413867"
                     /note="C-type lectin (CTL) or carbohydrate-recognition
                     domain (CRD); Region: CLECT; smart00034"
                     /db_xref="CDD:214480"
     misc_feature    order(976..978,1006..1008,1012..1014,1030..1032,
                     1036..1047,1054..1062)
                     /gene="LOC118413867"
                     /note="ligand binding surface [chemical binding]; other
                     site"
                     /db_xref="CDD:153057"
     misc_feature    1198..1308
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(1198..1200,1207..1209,1249..1251)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    1312..1422
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(1312..1314,1321..1323,1363..1365)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    1432..1536
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    1540..1650
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(1540..1542,1549..1551,1591..1593)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    1654..1764
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(1654..1656,1663..1665,1705..1707)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    1768..1878
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(1768..1770,1777..1779,1819..1821)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    1882..1992
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(1882..1884,1891..1893,1933..1935)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    1996..2106
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(1996..1998,2005..2007,2047..2049)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    2110..2220
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(2110..2112,2119..2121,2161..2163)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    2224..2334
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(2224..2226,2233..2235,2275..2277)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    2338..2448
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(2338..2340,2347..2349,2389..2391)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    2452..2562
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(2452..2454,2461..2463,2503..2505)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    2566..2676
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(2566..2568,2575..2577,2617..2619)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    2680..2790
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(2680..2682,2689..2691,2731..2733)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    2794..2904
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(2794..2796,2803..2805,2845..2847)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    2908..3018
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(2908..2910,2917..2919,2959..2961)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    3022..3132
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(3022..3024,3031..3033,3073..3075)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    3136..3246
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(3136..3138,3145..3147,3187..3189)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    3250..3360
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(3250..3252,3259..3261,3301..3303)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    3364..3474
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(3364..3366,3373..3375,3415..3417)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    3478..3588
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(3478..3480,3487..3489,3529..3531)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    <3619..3702
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    <3733..3816
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    3820..3930
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(3820..3822,3829..3831,3871..3873)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    3934..4044
                     /gene="LOC118413867"
                     /note="Calcium-binding EGF-like domain, present in a large
                     number of membrane-bound and extracellular (mostly animal)
                     proteins. Many of these proteins require calcium for their
                     biological function and calcium-binding sites have been
                     found to be located at the...; Region: EGF_CA; cd00054"
                     /db_xref="CDD:238011"
     misc_feature    order(3934..3936,3943..3945,3985..3987)
                     /gene="LOC118413867"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:238011"
     misc_feature    4051..4440
                     /gene="LOC118413867"
                     /note="C-type lectin (CTL) or carbohydrate-recognition
                     domain (CRD); Region: CLECT; smart00034"
                     /db_xref="CDD:214480"
     misc_feature    order(4351..4353,4363..4365,4369..4371,4387..4389,
                     4393..4404,4411..4416,4423..4425)
                     /gene="LOC118413867"
                     /note="ligand binding surface [chemical binding]; other
                     site"
                     /db_xref="CDD:153057"
ORIGIN      
tacaccgcacgcggcccagggatacccgcagacatgtctgtacagggaggctcgtggctgcttctgacgggcctggcgttgttcttctcctactctgcagccgtgtgcccactaccaaactacacaccgaccagcatcgacgggtactgctaccgggagaaagtggggatgtttgacttccatgcggccgagcacatttgtgaagaggacggtgctctcctcataacggataaaaacatatacagacatatgtggctccagttgaaagacttcgctcagggattctggctcggattggaggacgaagaggttccaggagagtactactggagtgacaatgaaactttgtccgagccgacattttgggaacctacaattcccgacgacccctcaaagcactgcgtcatctctgttcgaaatgggaccggaggagtcaccgcacagtcgaactgggtgcctgcggactgccacagctactacaccaacgtcgtctgtgaagttgataacgatgaatgtgcatcgaacacagagaacgcctgcaacgaacccaacatgcactgcgtgaacaccatcggctggtacgagtgtgagtgcgatgcagggtaccactgggagggcaacatatgtgccgaggagcacatcggcccgactgaagccccgatacacgatgaatgccccgtgggctgggacgacaccttcacgggcatgtgcatcaaggcgtttaccgtaaagtccaactggcccatggcgcattttacgtgcggcacgtcggagagggggcggctggtgaccatcgaagaccaggaaaagttagatttcatgaaaacttacgccgatgctcctaactactattggatcggattgaacgatgtgatggaggagggaacacttgtgtggacagacggggacgacctggaccctgccgagtttacccccgccgtcccgtggtcttcagaccccaattaccagaacacagacgccattgactgcgtctgcttcgccaaaggcatactcaatggcgtgtacaacacgtgggctttcgagtcatgtttaacgaagaaaaaattcatctgcgagatcgatctggacgagtgcagtgctaagccatgtctcaacaacggcacttgttacgaggagcaccctgtagggttcggctgcacatgcgaaccaggctacgaaggagatatctgcgagatagatgtagacgaatgcgctaacgtgacctgtgagaacggcggaacctgcgtcgacggcatcaacgaatactcctgcgattgtcctattggcattgaaggcactcactgcgaaataaatatagacgattgtcctggcgtgacctgtcagaacggcggaacctgcgtcgatggcatcaacgactactcctgcgactgtgttgatggctatgaaggcgagcactgtgaaacagagacagacgagtgtgatcccgatccgtgccagaacggcggaacctgtacggactcacttaatgccttcgactgctcgtgcacgcctggatgggagggggatacatgtgaaacaaatacggacgactgcgttggagtgaattgtcaaaatggcggaacctgcgtcgacgaagtggacggttactcctgcacttgtgctcctggctatgaaggtgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgaattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgttggagtggattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgttcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtccaaatggcgggacctgcgtcgacgaagtggacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatggcgggacctgcgtcgacgaagtggacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgaattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgttggagtggattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgttcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatggcgggacctgcgtcgacgaagtggacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgaattgtcaaaatggcgggacctgcgtcgacgatgttaacggttactcctgcacatgtgctcctggctatcaaggcgatcactgtgaaacagatacggatgactgccttggagtgaattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgttggagtggattgtcaaaatggcggaacctgcgtcgacgaagtggacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatggcggaacctgcgtcgacgaagttgacggttactcctgcacttgtgttcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatgggggaacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgttggagtgaattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgaattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgtaggagtggattgtcaaaatggcgggacctgcttcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatggctgcgttggagtggattgtcaaaatggcgggacctgcgttgacgaagttgacggttactcctgcacttgtgatcctggctatgaaggcgatcactgtgaaacagatagggaggactgcgttggagtggattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgttggagtgaattgtcaaaatggcggaacctgcgtcgacgaagttgacggttactcctgcacttgtgcacctggctatgaaggcgatcattgtgaaacagacacggacgaatgtagctccgagccctgtctaaacggtggaacttgcgaggatgacatcagtggctacacctgcacgtgtgctcttaactatgaaggagatcattgtgaaaccggttgtgaggccggttactggttatacaacggcagatgctactggttctctgacttctggcgcgaatacagcgacgcggaggacgcatgcgccacaagaggttcccttctggcgacggtgaaggatgccgggacgcacggcttcctttcaacgcagatccaagccacccaagatggaaggagccactggatcgggctgactgaccgagtaacggacggggagtacgtctggagtgacgggacctcgctcgggtcttaccaaccctggaggacaggggagttcgggttcggcgaccacacccggaaaggttgcgtcatgctgtggcacaccaggaacttcagctgggccaccacgcagtgtgagcataggtggaacctctacttcatctgcgagaaggctgctgtgacaacgactccatagccatcgcggcttcgacagaactaaacgttaccatgacaactgacttggatctgacggtttttttcgactaaagaacccaaggtttaactgagaacaaagatgcccaatatcaactctgttcatatttatagatagatcttaacagtcttattgctcataaacgctaatgtatactattagatatttctctaaatgccacagttgctgctttgattgtttgcccttgtgtcacacataccagcacctgcaatgcgtcatattttttcaacatctgtagtggcaagaccattcttaagaggacgattgattaaaaagaaaataactcccaaccacgggaactttgaacgtactatggtcccaactatggttaactatggtcccaactatggtcccaactatggtcccaactatggtcccaactatggtcccaactatggtcccaactatggttccaactatggtcccaactatggtcccgactgtgatcctaactatggtc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]