2024-04-26 06:51:11, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_035817457 4966 bp mRNA linear INV 13-AUG-2020 DEFINITION PREDICTED: Branchiostoma floridae fibropellin-1-like (LOC118413867), transcript variant X1, mRNA. ACCESSION XM_035817457 VERSION XM_035817457.1 DBLINK BioProject: PRJNA33245 KEYWORDS RefSeq. SOURCE Branchiostoma floridae (Florida lancelet) ORGANISM Branchiostoma floridae Eukaryota; Metazoa; Chordata; Cephalochordata; Leptocardii; Amphioxiformes; Branchiostomatidae; Branchiostoma. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_049982.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Branchiostoma floridae Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.5 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..4966 /organism="Branchiostoma floridae" /mol_type="mRNA" /strain="S238N-H82" /db_xref="taxon:7739" /chromosome="4" /sex="male" /tissue_type="testes" /country="USA: Old Tampa Bay, Florida" gene 1..4966 /gene="LOC118413867" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments" /db_xref="GeneID:118413867" CDS 34..4467 /gene="LOC118413867" /codon_start=1 /product="fibropellin-1-like isoform X1" /protein_id="XP_035673350.1" /db_xref="GeneID:118413867" /translation="
MSVQGGSWLLLTGLALFFSYSAAVCPLPNYTPTSIDGYCYREKVGMFDFHAAEHICEEDGALLITDKNIYRHMWLQLKDFAQGFWLGLEDEEVPGEYYWSDNETLSEPTFWEPTIPDDPSKHCVISVRNGTGGVTAQSNWVPADCHSYYTNVVCEVDNDECASNTENACNEPNMHCVNTIGWYECECDAGYHWEGNICAEEHIGPTEAPIHDECPVGWDDTFTGMCIKAFTVKSNWPMAHFTCGTSERGRLVTIEDQEKLDFMKTYADAPNYYWIGLNDVMEEGTLVWTDGDDLDPAEFTPAVPWSSDPNYQNTDAIDCVCFAKGILNGVYNTWAFESCLTKKKFICEIDLDECSAKPCLNNGTCYEEHPVGFGCTCEPGYEGDICEIDVDECANVTCENGGTCVDGINEYSCDCPIGIEGTHCEINIDDCPGVTCQNGGTCVDGINDYSCDCVDGYEGEHCETETDECDPDPCQNGGTCTDSLNAFDCSCTPGWEGDTCETNTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVDCQNGGTCVDEVDGYSCTCVPGYEGDHCETDTDDCVGVTCPNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVDCQNGGTCVDEVDGYSCTCVPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDDVNGYSCTCAPGYQGDHCETDTDDCLGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVDCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCVPGYEGDHCETDTDDCVGVTCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVDCQNGGTCFDEVDGYSCTCAPGYEGDHCETDTDGCVGVDCQNGGTCVDEVDGYSCTCDPGYEGDHCETDREDCVGVDCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDDCVGVNCQNGGTCVDEVDGYSCTCAPGYEGDHCETDTDECSSEPCLNGGTCEDDISGYTCTCALNYEGDHCETGCEAGYWLYNGRCYWFSDFWREYSDAEDACATRGSLLATVKDAGTHGFLSTQIQATQDGRSHWIGLTDRVTDGEYVWSDGTSLGSYQPWRTGEFGFGDHTRKGCVMLWHTRNFSWATTQCEHRWNLYFICEKAAVTTTP"
misc_feature 145..501 /gene="LOC118413867" /note="C-type lectin (CTL)/C-type lectin-like (CTLD) domain; Region: CLECT; cd00037" /db_xref="CDD:153057" misc_feature order(394..396,406..408,412..414,430..432,454..465, 472..480) /gene="LOC118413867" /note="ligand binding surface [chemical binding]; other site" /db_xref="CDD:153057" misc_feature 673..1077 /gene="LOC118413867" /note="C-type lectin (CTL) or carbohydrate-recognition domain (CRD); Region: CLECT; smart00034" /db_xref="CDD:214480" misc_feature order(976..978,1006..1008,1012..1014,1030..1032, 1036..1047,1054..1062) /gene="LOC118413867" /note="ligand binding surface [chemical binding]; other site" /db_xref="CDD:153057" misc_feature 1198..1308 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(1198..1200,1207..1209,1249..1251) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 1312..1422 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(1312..1314,1321..1323,1363..1365) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 1432..1536 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature 1540..1650 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(1540..1542,1549..1551,1591..1593) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 1654..1764 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(1654..1656,1663..1665,1705..1707) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 1768..1878 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(1768..1770,1777..1779,1819..1821) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 1882..1992 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(1882..1884,1891..1893,1933..1935) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 1996..2106 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(1996..1998,2005..2007,2047..2049) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 2110..2220 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(2110..2112,2119..2121,2161..2163) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 2224..2334 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(2224..2226,2233..2235,2275..2277) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 2338..2448 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(2338..2340,2347..2349,2389..2391) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 2452..2562 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(2452..2454,2461..2463,2503..2505) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 2566..2676 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(2566..2568,2575..2577,2617..2619) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 2680..2790 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(2680..2682,2689..2691,2731..2733) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 2794..2904 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(2794..2796,2803..2805,2845..2847) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 2908..3018 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(2908..2910,2917..2919,2959..2961) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 3022..3132 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(3022..3024,3031..3033,3073..3075) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 3136..3246 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(3136..3138,3145..3147,3187..3189) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 3250..3360 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(3250..3252,3259..3261,3301..3303) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 3364..3474 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(3364..3366,3373..3375,3415..3417) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 3478..3588 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(3478..3480,3487..3489,3529..3531) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature <3619..3702 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature <3733..3816 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature 3820..3930 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(3820..3822,3829..3831,3871..3873) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 3934..4044 /gene="LOC118413867" /note="Calcium-binding EGF-like domain, present in a large number of membrane-bound and extracellular (mostly animal) proteins. Many of these proteins require calcium for their biological function and calcium-binding sites have been found to be located at the...; Region: EGF_CA; cd00054" /db_xref="CDD:238011" misc_feature order(3934..3936,3943..3945,3985..3987) /gene="LOC118413867" /note="Ca2+ binding site [ion binding]; other site" /db_xref="CDD:238011" misc_feature 4051..4440 /gene="LOC118413867" /note="C-type lectin (CTL) or carbohydrate-recognition domain (CRD); Region: CLECT; smart00034" /db_xref="CDD:214480" misc_feature order(4351..4353,4363..4365,4369..4371,4387..4389, 4393..4404,4411..4416,4423..4425) /gene="LOC118413867" /note="ligand binding surface [chemical binding]; other site" /db_xref="CDD:153057" ORIGIN
tacaccgcacgcggcccagggatacccgcagacatgtctgtacagggaggctcgtggctgcttctgacgggcctggcgttgttcttctcctactctgcagccgtgtgcccactaccaaactacacaccgaccagcatcgacgggtactgctaccgggagaaagtggggatgtttgacttccatgcggccgagcacatttgtgaagaggacggtgctctcctcataacggataaaaacatatacagacatatgtggctccagttgaaagacttcgctcagggattctggctcggattggaggacgaagaggttccaggagagtactactggagtgacaatgaaactttgtccgagccgacattttgggaacctacaattcccgacgacccctcaaagcactgcgtcatctctgttcgaaatgggaccggaggagtcaccgcacagtcgaactgggtgcctgcggactgccacagctactacaccaacgtcgtctgtgaagttgataacgatgaatgtgcatcgaacacagagaacgcctgcaacgaacccaacatgcactgcgtgaacaccatcggctggtacgagtgtgagtgcgatgcagggtaccactgggagggcaacatatgtgccgaggagcacatcggcccgactgaagccccgatacacgatgaatgccccgtgggctgggacgacaccttcacgggcatgtgcatcaaggcgtttaccgtaaagtccaactggcccatggcgcattttacgtgcggcacgtcggagagggggcggctggtgaccatcgaagaccaggaaaagttagatttcatgaaaacttacgccgatgctcctaactactattggatcggattgaacgatgtgatggaggagggaacacttgtgtggacagacggggacgacctggaccctgccgagtttacccccgccgtcccgtggtcttcagaccccaattaccagaacacagacgccattgactgcgtctgcttcgccaaaggcatactcaatggcgtgtacaacacgtgggctttcgagtcatgtttaacgaagaaaaaattcatctgcgagatcgatctggacgagtgcagtgctaagccatgtctcaacaacggcacttgttacgaggagcaccctgtagggttcggctgcacatgcgaaccaggctacgaaggagatatctgcgagatagatgtagacgaatgcgctaacgtgacctgtgagaacggcggaacctgcgtcgacggcatcaacgaatactcctgcgattgtcctattggcattgaaggcactcactgcgaaataaatatagacgattgtcctggcgtgacctgtcagaacggcggaacctgcgtcgatggcatcaacgactactcctgcgactgtgttgatggctatgaaggcgagcactgtgaaacagagacagacgagtgtgatcccgatccgtgccagaacggcggaacctgtacggactcacttaatgccttcgactgctcgtgcacgcctggatgggagggggatacatgtgaaacaaatacggacgactgcgttggagtgaattgtcaaaatggcggaacctgcgtcgacgaagtggacggttactcctgcacttgtgctcctggctatgaaggtgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgaattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgttggagtggattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgttcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtccaaatggcgggacctgcgtcgacgaagtggacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatggcgggacctgcgtcgacgaagtggacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgaattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgttggagtggattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgttcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatggcgggacctgcgtcgacgaagtggacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgaattgtcaaaatggcgggacctgcgtcgacgatgttaacggttactcctgcacatgtgctcctggctatcaaggcgatcactgtgaaacagatacggatgactgccttggagtgaattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgttggagtggattgtcaaaatggcggaacctgcgtcgacgaagtggacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatggcggaacctgcgtcgacgaagttgacggttactcctgcacttgtgttcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgacttgtcaaaatgggggaacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgttggagtgaattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatgactgcgttggagtgaattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgtaggagtggattgtcaaaatggcgggacctgcttcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggatggctgcgttggagtggattgtcaaaatggcgggacctgcgttgacgaagttgacggttactcctgcacttgtgatcctggctatgaaggcgatcactgtgaaacagatagggaggactgcgttggagtggattgtcaaaatggcgggacctgcgtcgacgaagttgacggttactcctgcacttgtgctcctggctatgaaggcgatcactgtgaaacagatacggacgactgcgttggagtgaattgtcaaaatggcggaacctgcgtcgacgaagttgacggttactcctgcacttgtgcacctggctatgaaggcgatcattgtgaaacagacacggacgaatgtagctccgagccctgtctaaacggtggaacttgcgaggatgacatcagtggctacacctgcacgtgtgctcttaactatgaaggagatcattgtgaaaccggttgtgaggccggttactggttatacaacggcagatgctactggttctctgacttctggcgcgaatacagcgacgcggaggacgcatgcgccacaagaggttcccttctggcgacggtgaaggatgccgggacgcacggcttcctttcaacgcagatccaagccacccaagatggaaggagccactggatcgggctgactgaccgagtaacggacggggagtacgtctggagtgacgggacctcgctcgggtcttaccaaccctggaggacaggggagttcgggttcggcgaccacacccggaaaggttgcgtcatgctgtggcacaccaggaacttcagctgggccaccacgcagtgtgagcataggtggaacctctacttcatctgcgagaaggctgctgtgacaacgactccatagccatcgcggcttcgacagaactaaacgttaccatgacaactgacttggatctgacggtttttttcgactaaagaacccaaggtttaactgagaacaaagatgcccaatatcaactctgttcatatttatagatagatcttaacagtcttattgctcataaacgctaatgtatactattagatatttctctaaatgccacagttgctgctttgattgtttgcccttgtgtcacacataccagcacctgcaatgcgtcatattttttcaacatctgtagtggcaagaccattcttaagaggacgattgattaaaaagaaaataactcccaaccacgggaactttgaacgtactatggtcccaactatggttaactatggtcccaactatggtcccaactatggtcccaactatggtcccaactatggtcccaactatggtcccaactatggttccaactatggtcccaactatggtcccgactgtgatcctaactatggtc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]