GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-26 16:41:33, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_035454862            2409 bp    mRNA    linear   ROD 10-JUL-2020
DEFINITION  PREDICTED: Cricetulus griseus protein argonaute-1 (LOC100768807),
            transcript variant X4, mRNA.
ACCESSION   XM_035454862
VERSION     XM_035454862.1
DBLINK      BioProject: PRJNA72741
KEYWORDS    RefSeq.
SOURCE      Cricetulus griseus (Chinese hamster)
  ORGANISM  Cricetulus griseus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Cricetidae; Cricetinae; Cricetulus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_003613817.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Cricetulus griseus Annotation
                                           Release 104
            Annotation Version          :: 104
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2409
                     /organism="Cricetulus griseus"
                     /mol_type="mRNA"
                     /db_xref="taxon:10029"
                     /chromosome="Unknown"
                     /cell_line="CHO-K1"
     gene            1..2409
                     /gene="LOC100768807"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 3 Proteins"
                     /db_xref="GeneID:100768807"
     CDS             163..2409
                     /gene="LOC100768807"
                     /codon_start=1
                     /product="protein argonaute-1 isoform X4"
                     /protein_id="XP_035310753.1"
                     /db_xref="GeneID:100768807"
                     /translation="
MVQHFKPQIFGDRKPVYDGKKNIYTVTALPIGNERVDFEVTIPGEGKDRIFKVSIKWLAIVSWRMLHEALVSGQIPVPLESVQALDVAMRHLASMRYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWKMMLNIDVSATAFYKAQPVIEFMCEVLDIRNIDEQPKPLTDSQRVRFTKEIKGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLESGQTVECTVAQYFKQKYNLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLMKNASYNLDPYIQEFGIKVKDDMTEVTGRVLPAPILQYGGRNRAIATPNQGVWDMRGKQFYNGIEIKVWAIACFAPQKQCREEVLKNFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINVKLGGINNILVPHQRSAVFQQPVIFLGADVTHPPAGDGKKPSITAVVGSMDAHPSRYCATVRVQRPRQEIIEDLSYMVRELLIQFYKSTRFKPTRIIFYRDGVPEGQLPQILHYELLAIRDACIKLEKDYQPGITYIVVQKRHHTRLFCADKNERGTSRPSHYYVLWDDNRFTADELQILTYQLCHTYVRCTRSVSIPAPAYYARLVAFRARYHLVDKEHDSGEGSHISGQSNGRDPQALAKAVQVHQDTLRTMYFA"
     misc_feature    205..429
                     /gene="LOC100768807"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:435368"
     misc_feature    457..609
                     /gene="LOC100768807"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:430160"
     misc_feature    610..972
                     /gene="LOC100768807"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(766..768,811..813,853..855,865..867,919..921,
                     940..942,946..948)
                     /gene="LOC100768807"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1105..2280
                     /gene="LOC100768807"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1516..1518,1528..1530,1564..1575,1582..1584,
                     1606..1608,1615..1617,1627..1629,1639..1641)
                     /gene="LOC100768807"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(1720..1722,1726..1728,1936..1938,2248..2250)
                     /gene="LOC100768807"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
caggcacctcgacggcctggcattggcactgtgggcaaaccaatcaagcttctggccaattactttgaggtggacattcctaagattgatgtttatcattacgaggtggacatcaagccggataagtgtcctcgaagagtcaaccgggaagtggtggaatacatggtccagcatttcaagcctcagatcttcggggatcgcaagcccgtctatgatggaaagaagaacatttacactgtcactgcactgcccattggcaacgagagggttgactttgaggtgacaatccctggggaagggaaagatagaatttttaaggtctccatcaagtggctagccattgtgagctggcgtatgctacatgaagccctggtcagtggccagatccctgtgcccttggagtctgtgcaagccctggatgtggccatgaggcacctggcgtctatgaggtacacccctgtgggccgttccttcttctcaccgcctgagggctactaccacccgctggggggtgggcgcgaggtctggttcggctttcaccagtctgtgcgccctgccatgtggaagatgatgctcaacattgatgtatcagccactgccttctacaaagcacagccagtgattgagttcatgtgtgaggtcctggacatcaggaacatagatgaacagcccaagcccctcacagattcccagcgtgttcgctttaccaaggagataaaaggcctgaaggtggaagtgacccactgtggacagatgaagaggaaataccgcgtgtgtaatgttacccgacgccctgctagtcatcagacgtttcccttgcagctggagagtggacagactgtggaatgtactgtggcacagtatttcaagcagaaatacaaccttcaactcaagtatcctcacctgccctgcctacaagttgggcaagagcaaaagcatacctatttgcccctggaggtctgtaacattgtggccgggcagcggtgcattaagaagttgactgacaaccagacctcaaccatgataaaggctacagctaggtcggccccagacagacaggaggagatcagtcgcctgatgaagaatgccagctacaacttagatccctacatccaggaatttggaatcaaagtgaaggatgacatgacggaggtgacggggcgagtgctgccggcgcccatcttgcaatatggcggccggaatcgggccattgctacacccaaccaaggtgtctgggacatgcgtgggaaacaattctacaatggcattgagatcaaagtctgggccatcgcctgcttcgcaccccaaaaacaatgtcgagaagaagtgctcaagaacttcacagaccagctgcggaagatttccaaggatgcggggatgcccatccagggtcagccttgtttctgcaaatatgcacagggagcagatagtgtggagcccatgttccggcatctaaagaacacctactcaggactgcagctcattatcgtcatcctgccagggaagacgcctgtgtatgctgaagtgaaacgtgttggagacacacttttgggaatggcaacacagtgtgtgcaggtgaagaatgtggtgaagacctcacctcagactctgtccaacctctgcctcaagatcaacgtcaaacttggtggcattaacaacatcctagtcccacaccagcgctctgctgtttttcaacagccagtgattttcctgggcgcagatgttacacaccccccagccggggacgggaagaagccgtctatcacagcggtggtaggcagtatggacgcacaccccagccgatactgtgctactgtgcgtgtgcagcgcccacggcaggagatcattgaagacttgtcctatatggtgcgtgagctgctcatccagttctataagtccactcgcttcaagcccacccgcatcatcttctaccgagatggggtccctgagggccagctaccccagatccttcactatgagctgcttgccattcgagatgcctgcatcaaactggaaaaagactaccagcctgggatcacttacattgtggtgcagaaacgccatcatacccgccttttttgtgctgacaagaatgaacgaggtaccagccgaccatcccattattatgtcctttgggacgacaaccgtttcacagcagatgaactccagatcttgacataccagctgtgccacacttacgtacgatgtacacgttctgtctctatcccagcacctgcctactatgcccggttggtggctttccgggcacggtaccacctggtggacaaggagcatgacagtggagaggggagccacatatcagggcagagcaatggacgagacccccaggccctggccaaagctgtgcaggttcaccaggatacgctacgcaccatgtacttcgcttga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]