GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-09-14 02:44:19, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       XM_034148409            1486 bp    mRNA    linear   VRT 06-MAY-2020
DEFINITION  PREDICTED: Trematomus bernacchii all-trans-retinol
            13,14-reductase-like (LOC117496684), mRNA.
ACCESSION   XM_034148409
VERSION     XM_034148409.1
DBLINK      BioProject: PRJNA629536
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Trematomus bernacchii (emerald rockcod)
  ORGANISM  Trematomus bernacchii
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Eupercaria; Perciformes; Notothenioidei;
            Nototheniidae; Trematomus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_022987767.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Trematomus bernacchii Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 7% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..1486
                     /organism="Trematomus bernacchii"
                     /mol_type="mRNA"
                     /db_xref="taxon:40690"
                     /chromosome="Unknown"
     gene            1..1486
                     /gene="LOC117496684"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 96% coverage of the annotated
                     genomic feature by RNAseq alignments"
                     /db_xref="GeneID:117496684"
     CDS             1..714
                     /gene="LOC117496684"
                     /codon_start=1
                     /product="all-trans-retinol 13,14-reductase-like"
                     /protein_id="XP_034004300.1"
                     /db_xref="GeneID:117496684"
                     /translation="
MGAACAKSEMFFGKFKWPLFSQYLLVRAIEIKCVCTLLNILFIGLFHIISGVPPKESSFLINALLLQHYKRGAYYSQGGASEFAFHIINVIEKAGGAVLVRAPVHRVLLNRQNKAYGVTVLKGQEEIEVHAPVVISNAGIFNIFEKFLPQPIQEKPGVPPKESSFLINALLLQHYKRGAYYSRGAPVCLPSTSSMSLRRRAVLFSSGLRYTASCSTGRTRPMVGKELQTSSGIQLLF"
     misc_feature    <124..>453
                     /gene="LOC117496684"
                     /note="Phytoene dehydrogenase-related protein [Secondary
                     metabolites biosynthesis, transport and catabolism];
                     Region: COG1233"
                     /db_xref="CDD:440846"
ORIGIN      
atgggagcggcctgtgcaaagtcagagatgttttttggcaagtttaaatggcccttattttctcaatatttactggtccgggccatagagatcaaatgtgtctgtacgctgctcaatatcctcttcattggtctatttcatatcatttcaggtgtccctcctaaagagtccagctttctgatcaatgctctccttcttcaacactacaagcgtggtgcctactactcacaggggggcgccagtgagtttgccttccacatcatcaatgtcattgagaaggcgggcggtgctgttctcgtcagggctccggtacaccgcgtcctgctcaaccggcagaacaaggcctatggtgtgacggtgctcaaaggacaagaagagattgaggtccatgcccctgttgtcatttctaatgctggcattttcaacatattcgagaagtttctacctcagcccatacaggagaaaccaggtgtccctcctaaagagtccagctttctgatcaatgctctccttcttcaacactacaagcgtggtgcgtactactcacggggggcgccagtgtgtttgccttccacatcatcaatgtcattgagaaggcgggcggtgctgttctcgtcagggctccggtacaccgcgtcctgctcaaccggcagaacaaggcctatggtgggaaaagagttgcagacgagttctggaatacagttgcttttttgaatgagaccgtgcaaaggttgacctgttcatggagctcatgagacattctttcacacttttatcagtcttctaagcagagctatgtctttttgggctccaagccagaacagagattggaagtcggttgcatcacttcccgctttgttaaccgcttttcaaaacactctagaaattgttactaggctagaaccaaaacaaaaatgaggcaccagttttcaagcattttttggagttgggtgaacttctgcatttttaggagttggttaaacttaccaatattgtcattatcttagtttgttacacctgtttcctttattttctaattttcttgtctgcttttacttcctgtctttgtaattgttgattccttccacctgtgtgtgatctccagctttgttaatgttataagtatactgttcctatatatgtttaagtgttgatcattttatttggtactttcccttttttgcacttgcctgctttttagttttgtgtttttgtaaccagctttgatttgataaagctcgattttggtttttcatacctgcctcccctcttttgaactgcttttaaggccttatttccttacccttggtgctttaaggctgaaacatgcactgatgttattttacgtatgattaacactttgtgtgtgtgtgtcaggtgtgacggtgctcaaaggacaagaagagattgaggtccatgcccctgttgtcatttctaatgctggcattttcaacatattcgagaagtttctacctcagcccataca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]