GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-03-29 20:58:31, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_033903261             450 bp    mRNA    linear   INV 28-APR-2020
DEFINITION  PREDICTED: Pecten maximus uncharacterized protein DDB_G0290685-like
            (LOC117341412), mRNA.
ACCESSION   XM_033903261
VERSION     XM_033903261.1
DBLINK      BioProject: PRJNA625562
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Pecten maximus
  ORGANISM  Pecten maximus
            Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Bivalvia;
            Autobranchia; Pteriomorphia; Pectinida; Pectinoidea; Pectinidae;
            Pecten.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_047027.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Pecten maximus Annotation Release
                                           100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 100% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..450
                     /organism="Pecten maximus"
                     /mol_type="mRNA"
                     /db_xref="taxon:6579"
                     /chromosome="13"
     gene            1..450
                     /gene="LOC117341412"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 Proteins"
                     /db_xref="GeneID:117341412"
     CDS             1..450
                     /gene="LOC117341412"
                     /codon_start=1
                     /product="uncharacterized protein DDB_G0290685-like"
                     /protein_id="XP_033759152.1"
                     /db_xref="GeneID:117341412"
                     /translation="
MADGGSDDEVDGGDDMADGGSDDEVDGGDDMADGGSDDEADGGDDMADGGSDDEADGGDDMADGGSDDEVDGGDDMADGGSDDEADGGDDMADGGSDDEVDGGDDMADGGSDDEADGGDDMADGGSDDEADGGDDMADGGSDDEAASVV"
ORIGIN      
atggcagatggaggaagtgatgacgaggtagacggtggtgatgacatggcagatggaggaagtgatgacgaggtagacggtggtgatgacatggcagatggaggaagtgatgacgaggcagacggtggtgatgacatggcagatggaggaagtgatgatgaggcagacggtggtgatgacatggcagatggaggaagtgatgacgaggtagacggtggtgatgacatggcagatggaggaagtgatgatgaggcagacggtggtgatgacatggcagatggaggaagtgatgacgaggtagacggtggtgatgacatggcagatggaggaagtgatgacgaggcagacggtggtgatgacatggcagatggaggaagtgatgacgaggcagacggtggtgatgacatggcagatggaggaagtgatgacgaggcagcgtctgttgtttga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]