2024-03-29 20:58:31, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_033903261 450 bp mRNA linear INV 28-APR-2020 DEFINITION PREDICTED: Pecten maximus uncharacterized protein DDB_G0290685-like (LOC117341412), mRNA. ACCESSION XM_033903261 VERSION XM_033903261.1 DBLINK BioProject: PRJNA625562 KEYWORDS RefSeq; includes ab initio. SOURCE Pecten maximus ORGANISM Pecten maximus Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Bivalvia; Autobranchia; Pteriomorphia; Pectinida; Pectinoidea; Pectinidae; Pecten. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_047027.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Pecten maximus Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.4 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## ##RefSeq-Attributes-START## ab initio :: 100% of CDS bases ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..450 /organism="Pecten maximus" /mol_type="mRNA" /db_xref="taxon:6579" /chromosome="13" gene 1..450 /gene="LOC117341412" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 2 Proteins" /db_xref="GeneID:117341412" CDS 1..450 /gene="LOC117341412" /codon_start=1 /product="uncharacterized protein DDB_G0290685-like" /protein_id="XP_033759152.1" /db_xref="GeneID:117341412" /translation="
MADGGSDDEVDGGDDMADGGSDDEVDGGDDMADGGSDDEADGGDDMADGGSDDEADGGDDMADGGSDDEVDGGDDMADGGSDDEADGGDDMADGGSDDEVDGGDDMADGGSDDEADGGDDMADGGSDDEADGGDDMADGGSDDEAASVV"
ORIGIN
atggcagatggaggaagtgatgacgaggtagacggtggtgatgacatggcagatggaggaagtgatgacgaggtagacggtggtgatgacatggcagatggaggaagtgatgacgaggcagacggtggtgatgacatggcagatggaggaagtgatgatgaggcagacggtggtgatgacatggcagatggaggaagtgatgacgaggtagacggtggtgatgacatggcagatggaggaagtgatgatgaggcagacggtggtgatgacatggcagatggaggaagtgatgacgaggtagacggtggtgatgacatggcagatggaggaagtgatgacgaggcagacggtggtgatgacatggcagatggaggaagtgatgacgaggcagacggtggtgatgacatggcagatggaggaagtgatgacgaggcagcgtctgttgtttga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]