GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-12-06 06:04:08, GGRNA.v2 : RefSeq release 208 (Sep, 2021)

LOCUS       XM_033615908            2583 bp    mRNA    linear   VRT 20-APR-2020
DEFINITION  PREDICTED: Epinephelus lanceolatus pinopsin-like (LOC117249974),
            mRNA.
ACCESSION   XM_033615908
VERSION     XM_033615908.1
DBLINK      BioProject: PRJNA625542
KEYWORDS    RefSeq.
SOURCE      Epinephelus lanceolatus (giant grouper)
  ORGANISM  Epinephelus lanceolatus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Eupercaria; Perciformes; Serranoidei; Serranidae;
            Epinephelinae; Epinephelini; Epinephelus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_047014.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Epinephelus lanceolatus Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2583
                     /organism="Epinephelus lanceolatus"
                     /mol_type="mRNA"
                     /isolate="Andai001"
                     /db_xref="taxon:310571"
                     /chromosome="24"
                     /sex="female"
                     /tissue_type="blood and muscle"
     gene            1..2583
                     /gene="LOC117249974"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 28 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 2 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:117249974"
     CDS             465..1634
                     /gene="LOC117249974"
                     /codon_start=1
                     /product="pinopsin-like"
                     /protein_id="XP_033471799.1"
                     /db_xref="GeneID:117249974"
                     /translation="
MFSEVSDVDLTFNLGAPLSHLEQDWSDAPHERLSLSGHRVVSVCLGSIMVFGFLNNLLVLVLFCRFRSLRTPVNMLLLNISVSDMLVCACGTTLSFASSLRSRWLYGRTGCMWYGFVNSCFGIVSLVSLAVLSYDRYSTLMVYNKRVSDYRKPLLAVGAAWLYSVGWTVPPLLGWSSYGLEGAGTSCSVTWTERSSASHSYIVCLFVFCLGLPVLVMVYCYGRLLHAVKQVGHIRRTAARRREFHILFMIVTTVVCYLLCWMPYGVVAMMATFGRQGVVSPVAAVVPSILAKSSTVINPVIYILMNKQFYRCFLILLGCKHPLTESAHFAVPSKTTVVQLNRRPCDSSSRHATAAEPAPLTTQGSIHMEGTSAVKTDPAKPSDPASTVM"
     misc_feature    582..1403
                     /gene="LOC117249974"
                     /note="seven-transmembrane G protein-coupled receptor
                     superfamily; Region: 7tm_GPCRs; cl28897"
                     /db_xref="CDD:421689"
     misc_feature    582..662
                     /gene="LOC117249974"
                     /note="TM helix 1 [structural motif]; Region: TM helix 1"
                     /db_xref="CDD:410628"
     misc_feature    681..761
                     /gene="LOC117249974"
                     /note="TM helix 2 [structural motif]; Region: TM helix 2"
                     /db_xref="CDD:410628"
     misc_feature    795..887
                     /gene="LOC117249974"
                     /note="TM helix 3 [structural motif]; Region: TM helix 3"
                     /db_xref="CDD:410628"
     misc_feature    order(804..806,816..821,828..833,1020..1031,1077..1082,
                     1092..1094,1245..1247,1257..1259,1326..1328,1338..1340)
                     /gene="LOC117249974"
                     /note="putative ligand binding site [chemical binding];
                     other site"
                     /db_xref="CDD:410628"
     misc_feature    915..983
                     /gene="LOC117249974"
                     /note="TM helix 4 [structural motif]; Region: TM helix 4"
                     /db_xref="CDD:410628"
     misc_feature    1056..1148
                     /gene="LOC117249974"
                     /note="TM helix 5 [structural motif]; Region: TM helix 5"
                     /db_xref="CDD:410628"
     misc_feature    1185..1277
                     /gene="LOC117249974"
                     /note="TM helix 6 [structural motif]; Region: TM helix 6"
                     /db_xref="CDD:410628"
     misc_feature    1305..1382
                     /gene="LOC117249974"
                     /note="TM helix 7 [structural motif]; Region: TM helix 7"
                     /db_xref="CDD:410628"
ORIGIN      
gggttacttatatgtgagcgcgtggagcggagcgacagttgggcggcacgcaggaggacagagacttccgttctgtgagagcagagaagaagaagagtgagcgcggctcgtttatcacagaagaagtaatttattagcggattatcgatcctgtgatcgattacctgatatcgatcagagctggtgtctgttgccgccgccgctgctgcggcggaggatggagcggacagcaggagacggacggagcggcaggacgcttctcctgcggtagtctgactcctcttcatcatgtagctcctcttcatcatgtagctcctcttcatcatgtagctcctcttcatcatgtagctcctcttggcttttcactctctccacagaggacgtacccgcgcgctccgctccacactgcgccgtgccgtgcgtaaaagcggctccgactttagcagcccttttagcagcccgtcatgttctccgaggtgagtgacgtcgacctgacgttcaacctgggcgcgccgctgtcccatctggagcaggactggagcgacgcgccgcacgagcgtctgtcgctgagcgggcaccgcgtggtgtcggtgtgtctgggctccatcatggtgttcgggttcctcaacaacctgctggttctggttctgttctgccgcttccggtctctgcggactcccgtcaacatgctgctgctcaacatcagcgtcagcgacatgctggtgtgcgcgtgcggcacgacgctcagcttcgcctccagcctgcggagccgctggctgtacggccgcaccggctgcatgtggtacggcttcgtcaactcctgcttcggaattgtgtcactggtctccctggccgtcctgtcctacgaccgctacagcaccctgatggtgtacaacaagcgggtgtcggactacaggaagccgctgctggcggtgggcgcggcgtggctgtactcagtgggctggacggtgccccccctgctgggctggagcagctacggtctggagggggcggggaccagctgctcggtgacgtggacggagaggtcgtccgcctctcactcgtacatcgtctgtctgttcgtcttctgtcttggcctccccgtcctcgtcatggtgtactgctacggacgcctgctgcacgccgtcaaacaggtgggtcatatcaggcgcacggcagctcgtcgcagagagttccacatcctgttcatgatcgtcaccacggtggtgtgttacctgctctgctggatgccgtatggtgtcgtcgccatgatggccaccttcggccggcaaggagtcgtcagccccgtcgccgccgttgtcccatcgatcctcgccaagagcagcaccgtcattaaccccgtcatctacatcctcatgaacaaacagttctaccgctgcttcctgatcctgctcggctgtaaacacccgctgacggagagcgctcacttcgccgtgccctcaaagaccaccgtggtccagctcaaccgccgaccgtgtgacagcagctccagacacgccaccgccgctgagccggcgccgctcaccacacagggcagcatccacatggagggaaccagcgccgtcaaaacagaccccgccaaaccatctgaccccgcctccactgtgatgtaagcgcgatgtcaccctgtgagtcagcgatgaaaacacgttaacatccacaatatgaacacactgacgtgtgcggacatgtggacacgtatgtaaacatgtgccacagacatgtttacatttattaacatgaacacaacaacaaacaataaataaaacattaaaatcatcctgatgtttaaacataagaataaatgcttcgctattaacgaaggcattttcagagagtccgtcctcatcaacgtgatcgctacagagcgcaccagggcaatatcctcagatttggcacaaacatccacgcggacgcaacaatgaataaatcagaatttggtggtcgaaggtcattgtgaccttgcatctgtttcatttttgtgagtgcaatatctcaagaaggccttgaggtaagttccttaaattttgacaagaacgtccacttggactaaatgataaactgattagaatttggtggtcaaaggtcaaggtcatccatcttgttcttttgggtgccatatctcaagagggccttgaatttcttcagatttggcaccaacggccatcttgactcaacgataaactaattagaagttagaggttgaaggtcactgtgaccttgtccatctcattcttgtaaatgtgatatctcaagaaggccttgaggtgagttcctgaaatttggcacaaacattcatttggactcaacaataaactgataagaatttggtggtcaaaggtcaaggtaactgacctcacaaaacttcctaactcaacccttcatatcctgatcacacgtcaccgcagccgagagctggacatctctgtaactgattgattgattgattgattgattgattgactgaataaaatgtgaatatttttctatgctctctggtccgtctgttgctgtaaaaatgttctgttgagttgaataaataaatttgtgtgatgctctccg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]