2024-03-28 18:50:19, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_033045227 3634 bp mRNA linear VRT 02-APR-2021 DEFINITION PREDICTED: Amblyraja radiata protein argonaute-3 (LOC116988484), transcript variant X4, mRNA. ACCESSION XM_033045227 VERSION XM_033045227.1 DBLINK BioProject: PRJNA610638 KEYWORDS RefSeq. SOURCE Amblyraja radiata (thorny skate) ORGANISM Amblyraja radiata Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Chondrichthyes; Elasmobranchii; Batoidea; Rajiformes; Rajidae; Amblyraja. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_045982.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Updated annotation Annotation Name :: Amblyraja radiata Updated Annotation Release 100.20210331 Annotation Version :: 100.20210331 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.6 Annotation Method :: Best-placed RefSeq; propagated RefSeq model Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3634 /organism="Amblyraja radiata" /mol_type="mRNA" /isolate="CabotCenter1" /db_xref="taxon:386614" /chromosome="27" /sex="male" /tissue_type="testis, liver" /country="USA: Gulf of Main" /lat_lon="43.1336 N 68.3266 W" /collection_date="2017-09-18" /collected_by="Jeff Kneebone" gene 1..3634 /gene="LOC116988484" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 4 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 11 samples with support for all annotated introns" /db_xref="GeneID:116988484" CDS 108..2555 /gene="LOC116988484" /codon_start=1 /product="protein argonaute-3 isoform X4" /protein_id="XP_032901118.1" /db_xref="GeneID:116988484" /translation="
MREVVDSMVQHFKVQIFGERRPVYDGKKSLYTADPIPVSTTGVDLEVTLPGEGKDRIFRVSIKFVSRVSWHLLHEVLTGRSMPELLPGLDLDKPLSTNPVHAVDVVLRHLPSMKYTPVGRSFFSAPEGYDHPLGGGREVWFGFHQSVRPAMWKMMLNIDVSATAFYKAQPVIQFMCEVLDIHNIDEQPRPLTDSHRVKFTKEIKDKLLTGLKVEVTHCGPMRRKYRVCNVTRRPASHQTFPLQLENGQTVECTVAQYFKQKYNLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISKLVKNANYDADPFVQEFQFKVRDEMAHVTGRVLPAPMLQYGGRVEPSHFRLQTNRTVATPSHGVWDMRGKQFHTGVEIKMWAIACFAAQRQCREEVLKSFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLVIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINVKLGGINNILVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPSRYCATVRVQRPRQEIIQDLASMVRELLIQFYKSTRFKPTRIIFYRDGVSEGQFRQVLYCELLAIREACISLEKDYQPGITYIVVQKRHHTRLFCADKNERVGRSGNIPAGTTVDTDITHPYEFDFYLCSHAGIQGTSRPSHYHVLWDDNCFSADELQLLTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDSAEGSHISGQSNGRDPQALAKAVQIHQDTLRTMYFA"
misc_feature 138..428 /gene="LOC116988484" /note="N-terminal domain of argonaute; Region: ArgoN; pfam16486" /db_xref="CDD:435368" misc_feature 456..608 /gene="LOC116988484" /note="Argonaute linker 1 domain; Region: ArgoL1; pfam08699" /db_xref="CDD:430160" misc_feature 609..986 /gene="LOC116988484" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(780..782,825..827,867..869,879..881,933..935, 954..956,960..962) /gene="LOC116988484" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 1119..2426 /gene="LOC116988484" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1560..1562,1572..1574,1608..1619,1626..1628, 1650..1652,1659..1661,1671..1673,1683..1685) /gene="LOC116988484" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" misc_feature order(1764..1766,1770..1772,1980..1982,2394..2396) /gene="LOC116988484" /note="active site" /db_xref="CDD:240015" ORIGIN
cctcttcacggtgccaaggcgtccaggatgtggcaccatgggaaaaccgattaaactgctggccaactgcttccaagtagatatcccaaagattgacgtctacctctatgagggaagtggttgactctatggttcagcattttaaagttcaaatatttggagaaagaagacctgtctacgatgggaaaaagagtctctatactgctgatcccattccagtcagcaccacgggggtggatttggaggtgacgttaccaggagaagggaaagaccggattttcagggtctcaataaaatttgtttcaagagtgagttggcacttgctacatgaagttcttacaggacggagtatgccggagttgctgcccgggttggatctggacaagcctctcagcacaaatcctgtccatgcagttgatgttgttcttcgacatctcccctccatgaagtacacccctgttggccgctctttcttctctgcccccgaagggtatgaccatccattgggtgggggtagagaagtctggtttggttttcatcagtctgtcagaccagccatgtggaaaatgatgctgaacatagatgtttctgccactgctttctataaagcacagccagtaattcagttcatgtgtgaagttctagacatacataatattgatgaacaaccacgacctttgactgattcccatcgcgtcaaattcaccaaagagataaaagacaaacttctcacaggattgaaagttgaagtaactcactgtggacctatgaggagaaagtaccgtgtgtgcaacgtcaccagacgaccagccagtcatcaaacgttccccttacagctggaaaatggacagactgtggaatgcactgtggcgcaatatttcaaacagaaatacaaccttcagttaaaatacccacacctaccctgtctgcaggtgggacaggagcagaaacacacctatctgccactggaggtctgtaacattgtggcgggacagcgttgtatcaagaaactgacggacaatcagacatcaacaatgatcaaagcaacagcacgctcagcacctgatagacaagaggaaataagtaaattggtaaaaaatgcaaactatgacgctgatccttttgtccaggagtttcagtttaaagttcgagatgaaatggctcatgtgactggccgagtacttccagcccccatgctgcagtatggggggagggtggaaccaagtcattttagattacaaactaatcgtacagttgctactccaagtcatggtgtttgggacatgcgggggaaacagtttcatactggggttgaaatcaaaatgtgggcaatagcatgttttgcagcacagagacaatgtagagaagaagtacttaagagtttcactgaccagctacggaaaatatctaaagacgccggaatgccaattcagggccagccatgtttttgtaaatacgcacaaggagctgatagtgtggagccaatgttcaggcatctgaagaatacgtattcaggcctacaacttgttattgttattttacctgggaaaacacctgtctatgctgaagtgaagcgtgtgggagatactctactagggatggccactcagtgtgttcaggtgaagaatgttgttaaaacatctccacagacgttatcaaacctctgcctgaagattaatgtgaaattaggtggaatcaacaacattttggtaccacatcaacgaccatccgtgttccagcaacctgtgatttttctgggagctgatgttacacatccaccagctggagatggcaagaaaccctcaatcgctgctgttgtaggcagtatggatgcccatcctagtcgttactgtgccactgtgcgtgtacagagaccacgacaggagatcattcaagatttagcatctatggttcgagaacttctcatacagttttacaaatcaacgcgttttaagccgacccgaattatattttatcgtgatggagtttctgaagggcagtttcgtcaggttttgtattgcgagcttttggcgattcgagaagcatgcattagcctggagaaagactatcaacctggtattacatatatagtggtgcagaaacggcatcatacacgattattctgtgctgataagaatgaaagggttgggagaagtggaaatattccagcaggaaccacggtagatacagatatcacccacccatatgaatttgatttttatctctgcagccacgctgggatacaggggacaagtcgcccttctcactatcatgttctgtgggatgacaactgcttctctgcggatgagcttcagcttcttacctatcaactgtgtcacacgtatgtgcgttgcacacgctctgtatctatcccagcaccagcgtattatgcacatctagtggcatttagagcaaggtaccatttggtggacaaagagcatgacagtgctgaaggcagtcacatttctggtcagagtaatggacgtgaccctcaggctcttgccaaggctgtgcagattcaccaggacacattgcgcactatgtacttcgcttaagtttgggaaattctctccagaaggaaccgaaaatcacagcctgcaattccagtggggtcagtttacgggcatgtctccagccatactgtaactttcactgtgtggggacaataatttcataaactgacgaaaagagattgtttacctacgaagatcatagcactattatgcaatatgaaaccagccaactgctctgtgtgtgtgtgtgtgtgtgtgtgtgtatgtatgcgcgtgtgggtgtgtgcatgtgcgtgcgtgctccgtcagacctcgtgtctgtctttcctttttttttctccagtatagtttcctttttgcctttacctcagtgtttggcagcacaaacgtcatgcaacatgaaaatgggacaaagaaaaatgtttgacaaaacttggatctcaaaacaagtcactaattagttcaaaggtccaatcatttgcttggagtcttcaacttggaagggtgggtggttggagaaggaggtgaagacttgcttgaaaaaaaatattctagggaataactaccaatgctttataagatccaaaagtccacctccaccaggccacttttcaaattctgcatactcatcaattagtgagttaaatcaacagattattgaactcggctactagttatggttgagcaccataaacagtgcagtggaattttgtatagaagataatatccatgtcttggataacccttaattattgacgatataagatcttttgaaaattccaagaaatggggctatgtttaatgtagaaacttctgctttttgttactgtttacttgctaactcacaacaaaatgtgatgttttctgttttagcatcctatatttattagaaaaaataatgcttaatttaatatggatttacattaaagtatagtagcatcaattctatttagttctggaatgtaaccgtgttgtatactgacagaacattgctaccgttagtgcaataagcggttggtaagaaagcccgtgtcctacgctgttctggagcagcagttgtaccactataatcgtgggagagtggacacctccgcacttcagaaccttatcagttttaataa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]