GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-12-06 05:35:01, GGRNA.v2 : RefSeq release 208 (Sep, 2021)

LOCUS       XM_033027547            4160 bp    mRNA    linear   VRT 02-APR-2021
DEFINITION  PREDICTED: Amblyraja radiata NRDE-2, necessary for RNA
            interference, domain containing (nrde2), mRNA.
ACCESSION   XM_033027547
VERSION     XM_033027547.1
DBLINK      BioProject: PRJNA610638
KEYWORDS    RefSeq.
SOURCE      Amblyraja radiata (thorny skate)
  ORGANISM  Amblyraja radiata
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Chondrichthyes;
            Elasmobranchii; Batoidea; Rajiformes; Rajidae; Amblyraja.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_045964.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Updated annotation
            Annotation Name             :: Amblyraja radiata Updated Annotation
                                           Release 100.20210331
            Annotation Version          :: 100.20210331
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.6
            Annotation Method           :: Best-placed RefSeq; propagated
                                           RefSeq model
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4160
                     /organism="Amblyraja radiata"
                     /mol_type="mRNA"
                     /isolate="CabotCenter1"
                     /db_xref="taxon:386614"
                     /chromosome="9"
                     /sex="male"
                     /tissue_type="testis, liver"
                     /country="USA: Gulf of Main"
                     /lat_lon="43.1336 N 68.3266 W"
                     /collection_date="2017-09-18"
                     /collected_by="Jeff Kneebone"
     gene            1..4160
                     /gene="nrde2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 6 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 15 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:116977182"
     CDS             50..3502
                     /gene="nrde2"
                     /codon_start=1
                     /product="nuclear exosome regulator NRDE2"
                     /protein_id="XP_032883438.1"
                     /db_xref="GeneID:116977182"
                     /translation="
MEPPSASLFPAFTGTAATSAGSAAGLDWLSNRSFRTEDALQLHQRMVGIAADSPQGSPQASTYSDRDASGTLSPRLVVSGEEHPAAKKKKKKKKHHRHKKEKKKSRERDHSIGNSDPELLWEKGKQPSTVRNDVCADLPAGEFMWLDDIQSPSGQSFCIDRKADPANWMYKSLYRGDLARYKRKGDVCIGLNPKKQQILWEGPKQQKKKRAKRREDRYYSTSSLQQLRTDAVAVRCEVASQSNTPAVAPAFIPVPDWEESESRSAGTVSWVNPLGIYDASTSLWLQGKGRPEQEDKGRVPTDSGEEVNAAMLAKVERFNRLLREDSSNVQTWMEFVHFQDELMQGPNPFTAATGESEKRKRSRRMVLEKKLAILERGIESNPSRVELKVARLQLCQEAWEPSSLVNEWKKVVFLHPNDTALWQRYLLFYQSQFSTYSTSKVNGTYGKCLSTLAAALDGTLVSHPALPGIEEAMLAIFLQQCHFLRQAGHSEKAIALFQALIDFTFFKPDSMARLTTKAQVEFFEPFWDSGEPRFGEAGARGWKAWMRQQEKGGWIILNEEGEDEEEDEDGEEIKDKSRPKWQLWVQVEGARDAKYWLPWRAKKVKGQAEEDCEDPDRQVLFDDIGDSMFRICSPGLKFQLLSCFLRFLGVPAGSELPPSCLNLALDEPALLASGSEGAMLADGSGPSTGGVAAVGLLDAGPRPGTGHCRAGEEFIRFVFQQALPHLSGEEQSELALSWLLYEKSKVVQNLRLGSKRVKPQGKRSKRLAKRLLKEPANRNSLALWREFAHLEWLLGNVDESRRVFHTAVSSDAAQGLSSSSLCRLCLLYASLELELEVAGQAACPRALHVLTRLAQGDGRPFAGEVPAVDVLKARRSYEQAVRCLPADPAHLASLAGCYALFLYLTVGLQAADTLYRQAADWLDVLPPPAESAPAASSRVSASRRLATMHVALLWFHARAGPRPRRPLVEALQAALRRFPGSPRLWRLFVRLASTAPHSGSTARRFFHSLTRANRGDILPWLFAIHAEEQRKQRIDSVLRAGAGMEHSMVPETGLDNRIAALFEHAVGSEAGAHCVLLWRMFLRFTAARGDVGRTRGVFYRALQHCPWAKVLYLDAVRLLPERLQEITDLMTEKEIRLRLPLEELDILVED"
     misc_feature    515..817
                     /gene="nrde2"
                     /note="MTR4-interacting domain (MID) found in nuclear
                     exosome regulator NRDE2 and similar proteins; Region:
                     NRDE2_MID; cd22200"
                     /db_xref="CDD:412062"
     misc_feature    order(515..541,548..553,563..568,572..574,578..622,
                     629..637,641..649,668..676,686..688,695..697,701..706,
                     713..733,758..769,788..817)
                     /gene="nrde2"
                     /note="MTR4 binding site [polypeptide binding]; other
                     site"
                     /db_xref="CDD:412062"
     misc_feature    1001..1996
                     /gene="nrde2"
                     /note="necessary for RNA interference; Region: NRDE-2;
                     pfam08424"
                     /db_xref="CDD:400637"
ORIGIN      
gcggcccggcgacagtgacggcatcggaaagcgacgcggcctagggaggatggagccgccgtcggcctcgctctttcctgccttcaccggcaccgcagcgaccagcgccggctccgccgcaggattggattggctcagtaatcggagcttccgcactgaggatgccctgcagctgcaccaacgcatggtggggattgcagcagactcgccccaggggtcaccgcaggcaagcacttattccgaccgtgacgcgtctgggacactgtcccccagattggttgtcagcggggaagagcaccctgcggccaaaaagaagaaaaagaagaaaaaacatcatcgtcacaaaaaagagaagaagaaaagccgagagagagatcattccatcggtaactctgaccctgagctcctctgggagaaaggcaagcagcccagcactgtgaggaatgatgtctgtgccgatcttcctgcgggtgaattcatgtggctggatgacattcaatcgccttctggccagagcttctgcatcgacaggaaggctgatcctgccaactggatgtacaaatcgctctatcgtggcgacctggcaaggtacaagaggaaaggggatgtatgcattggccttaaccccaaaaagcagcagatcctttgggaaggtcccaagcaacagaagaagaagagggcgaagaggagggaggatcgatactacagcacatcgagccttcagcagctgaggactgacgcggttgccgtccgttgtgaagttgcttcgcagagcaacacccccgccgtcgcgccggccttcatccccgtgccggactgggaagagagcgagagtcgatcggcgggcaccgtcagttgggtcaatccgctggggatctacgacgcttccaccagcctgtggctgcaggggaagggacggcccgagcaggaagacaaaggccgcgtccccacggactccggtgaggaagtgaatgccgctatgctggccaaggtggagaggttcaacaggttgctgagggaggactcgagcaacgtccaaacctggatggagttcgttcattttcaggatgagttaatgcaaggtccaaatccgttcacggcggccacgggggaatctgagaagaggaagaggtcacggcggatggtcctggagaagaagctggctattttggagcggggcatcgagagcaaccccagccgggtggagctgaaggtggcccgtctgcagctgtgccaggaggcctgggagccgtccagcctggtcaacgagtggaagaaagtggtcttccttcaccccaacgacaccgccctgtggcagcgctacctcctgttctaccagagccagttcagcacctactcgacgtccaaggtcaatggcacctacggcaaatgtctcagcaccctggcggctgccctggacgggacgctcgtgtcccatcccgcccttcccggcatcgaagaagccatgctggcaattttcctgcagcagtgtcatttcttgcggcaggccggccattcggaaaaggccattgccctcttccaggctctgattgacttcaccttcttcaagcctgacagcatggccaggctgacaaccaaagcacaggtggagttcttcgagccgttctgggatagcggtgagccccggtttggagaagcgggagcgagaggttggaaggcctggatgcgacagcaggagaaaggtggatggattatcctgaacgaggaaggagaggatgaggaagaggatgaagatggggaggagatcaaggacaagagccgacccaagtggcagctctgggtgcaggtagaaggtgcccgcgacgccaagtactggttgccatggcgagccaagaaggtgaagggtcaagctgaggaggattgcgaggatcctgacaggcaggtgctgtttgatgacattggcgactcgatgttcaggatctgcagccccgggctgaagttccaactcctgtcctgcttcctgcgtttcctgggggtccccgccggctcggagctgcccccctcctgcctgaacctggcgctggacgagccggccctgctggccagcggatcggagggcgccatgctggcggacggctccggcccttcgaccggcggggtggcggctgtcggcctcctggacgcggggccccgaccggggaccgggcactgcagggccggggaggagttcatccgcttcgttttccaacaagccctgcctcatctctccggggaagagcagtcggagctggctctgagctggctgctctacgagaaatccaaggtggtgcagaacctgcgtctgggaagcaagagggtgaagccgcagggcaagaggagcaagcggctggccaagaggctgctgaaggagccagccaaccgcaacagcctggccttgtggagggagtttgcccacctggagtggctgctgggcaacgtggacgagtcgcggcgggtcttccacacggccgtgtcctccgatgccgcgcagggactgtccagctcctcgctctgccggctctgcctcctctacgcctcgctggagctggagctggaggtggcggggcaggcggcttgccctcgcgccctgcacgtgctgaccaggctggcccagggggacgggcggccgttcgctggtgaggtgccggcggtggacgtgctgaaggcgcggcggagctacgagcaggcggtacggtgtctccccgccgaccccgctcacctggccagcctggccggctgctacgccctcttcctctacctcacggtgggcctgcaggccgccgacactctctaccggcaggcggccgactggctggacgtgctgccccccccggcggagtcggcgccggccgcatcctcgcgcgtctccgcctcgcgccgcctggccaccatgcatgtggcgctgctgtggttccacgcccgggcgggcccccgccccaggcggcccctggtcgaggcactgcaggctgccctgcgccgcttccccggcagcccgcgcctctggcggctcttcgtgcggctggccagcaccgcgccgcacagcggcagcaccgcacgccgcttcttccacagcctcacccgcgcaaacagaggcgacatcttgccatggctgttcgccatccacgcagaggagcagaggaagcagcgcatcgactcagtactgagggcgggtgctgggatggagcacagcatggtgccggagacgggcctggacaatcgtatcgcagcgctgtttgagcatgccgtggggtcggaggcgggagcgcactgcgtcctgctctggaggatgttcctgcggtttacggcggcgcgaggggatgtggggcggacgagaggtgtgttctacagagcgctgcagcactgtccctgggccaaggtgctgtacttggacgcagtccgtctgctacccgagcggctgcaagaaatcactgacttgatgaccgagaaggaaatccgcctccggcttcccctcgaagagctggacatcctggtggaagattaacgaggaacccatcctggtcgaagatgaacgaggaaccgatcctcatcgaagattaacgaagaaccgatcctcatcgaagatgaacgaggaaccgatcctcatcgaagattaacgaagaactgatcctcatcgaagatgaacgaggaaccgatcctcattgaagattaacgaagaaccgatcctcatcgaagattaacgaagaaccgatcctcatcgaagattaacgaggaacccatcctggtcgaagattaacgaggaactgatccaggtcgaagattaatgaaggatcgatcctcatcgaagattaacgaagaaccaatcctggtcgaagattaacgaagaaccaatcctggtcgaagattaacgaagaaccgatcctggtcgaagattaacgagggactgatcttggacgaagattaacgaagaaccgatccagatggacgattaaagaggaacggccaccttcctccatctcacaggccatccggagtcacgggtgggggacacggattccctgtcctcagcccaaggcaacagcgggttcacacacggacacattcctcccctcagccccttctcccaccctttctccctctctccccctctctccctccctcaccctccccctctctccctccctcactctccctcctccccc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]