LOCUS       XM_032669947            3774 bp    mRNA    linear   INV 27-FEB-2020
DEFINITION  PREDICTED: Danaus plexippus plexippus copper-transporting ATPase 2
            (LOC116776693), transcript variant X1, mRNA.
ACCESSION   XM_032669947
VERSION     XM_032669947.1
DBLINK      BioProject: PRJNA607945
KEYWORDS    RefSeq.
SOURCE      Danaus plexippus plexippus
  ORGANISM  Danaus plexippus plexippus
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Endopterygota; Lepidoptera; Glossata;
            Ditrysia; Papilionoidea; Nymphalidae; Danainae; Danaini; Danaina;
            Danaus; Danaus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_045834.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Danaus plexippus plexippus
                                           Annotation Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3774
                     /organism="Danaus plexippus plexippus"
                     /mol_type="mRNA"
                     /isolate="F-2"
                     /sub_species="plexippus"
                     /db_xref="taxon:278856"
                     /chromosome="28"
                     /sex="female"
                     /country="USA: Greenfield, Massachusetts"
                     /lat_lon="42.98 N 73.00 W"
                     /collection_date="Oct-2008"
     gene            1..3774
                     /gene="LOC116776693"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 3 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 9 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:116776693"
     CDS             67..3606
                     /gene="LOC116776693"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X1"
                     /protein_id="XP_032525838.1"
                     /db_xref="GeneID:116776693"
                     /translation="

MTCQSCVRSIEGSVRELPGIHYVKVELSEKAGYFKYDPSACSADSIRSHIEDMGFEVTDNSDGETRNLLNPEIPTDTLIDMSTDASLLLAVVGMTCQSCVDSIQGALKDVPGVTSSTVSLAQGTALVTFTPAEVTPDLIKDTIYNLGFDVDIISVTDKEAENKDQGGSGDRRARAGGGEATAKTNGNAPSEISRCTLEVKGMTCASCVAAIEKHCAKLTGVHSIVIALLAAKAEVRYEPAKISAAAIADSITELGFSSELISDSGAPKDLNLLIKGMTCASCVNKIEKSLMKLTGVVSCSVALTTSKGKVKYDPEVIGARRICDAVGDLGFEANVVGSQHKGTANYLEHKEEIRRWRNAFLVSLIFGAPCMAAMTYFMLGMGHHSARDMCCVLPGLSLENLLLWLLATPVQFIGGWHFYKQAYKALRHGTSNMDVLISMTTTISYLYSVGAVSAAMALQKDTSPLTFFDTPPMLLVFVSLGRWLEHIAKGKTSEALSKLLSLKPTEAVLVTLDPEGREISEKNIPVDLVERGDILKVVPGAKIPVDGKVISGQSTCDESLITGESMPVAKTKDSLVIGGSMNQHGALLVRATHTGEASTLAQIVRLVEDAQSSKAPVQRLADTIASYFVPMVVFLSLLTLVCWTISGALDVDRIKAITPEIYRDAGFSDWELIVQTAFHFALSVLAIACPCALGLATPTAVMVATGVGARLGLLIKGAEPLENAHKVKTVIFDKTGTVTRGDTSVARVSILTGDPSTLPEVITCILTAELNSEHPVASAIVRWCTSVVGSPRALVRGFTAAPGCGLRARVLLTERPPGLDKDGVLSHLGGVPVELVGGEGDAALSSAQAAARLQRVIKAAEQGEEVEQVVLIGNREWMHRNGVMVPRRVQEQLRTDEELGRTAVLVAINDQLVCTIGVSDQVKPEAHLAVYCLKKMGLEVCLLTGDNKKTAAAIARQVGINKVFAEVLPSHKVAKVQELQDKGQKVAMVGDGVNDSPALARADVGVAIASGTDVAVEAADLVLMRSDLLDVVSCLQLSRVTVRRIRMNFVFASVYNLLGIPLASGAFALYGLQLQPWMASAAMAMSSVSVVCSSLLLKTFRKPTMEQLKTPEYLQSLHQEQLEQLEAVAVHRGLDEKLDPQDKGTPLAKLFTRSKSTDDFLLREEDDLLTVSFIPKRSS"

     misc_feature    67..240
                     /gene="LOC116776693"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(67..75,82..84)
                     /gene="LOC116776693"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    331..516
                     /gene="LOC116776693"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(346..354,361..363)
                     /gene="LOC116776693"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    652..843
                     /gene="LOC116776693"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(670..678,685..687)
                     /gene="LOC116776693"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    886..1065
                     /gene="LOC116776693"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(895..903,910..912)
                     /gene="LOC116776693"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1144..3297
                     /gene="LOC116776693"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(2131..2133,2137..2139,3229..3231)
                     /gene="LOC116776693"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(2263..2271,2467..2469,2680..2688,2776..2778,
                     2896..2904,2962..2964,2971..2973,2980..2982,3037..3039,
                     3046..3048)
                     /gene="LOC116776693"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      

taatgtcgtggtctctacagtgatcccagtccagacctggtctccgtgcgtgtccccatccatggcatgacctgccagtcctgtgtgaggagcatcgagggatcagtccgggaactgccgggaattcactacgttaaggtggagctgtcagagaaggctggttatttcaagtatgaccccagcgcgtgctccgcggacagcatccgctctcatatagaagatatgggcttcgaggtcacggacaacagtgacggagagacgcggaacctcctcaacccagagatccccaccgacacgttgatagacatgagcacggacgccagcctgctgctcgctgtggtggggatgacctgccagtcctgtgtcgattccatacagggtgccctcaaagacgtcccaggtgttaccagctcaacagtcagcctggcccagggcacggcgctggtgaccttcaccccggccgaggtcactccggacctcattaaggacaccatctacaacctcggcttcgacgtggacatcatcagcgtcactgacaaagaagcagagaataaggaccagggcggctccggggacaggcgggcgcgcgcgggagggggggaggccaccgcgaagacgaacggtaacgcgccgtcagagatatccaggtgcaccctggaggtgaagggcatgacgtgcgcctcgtgtgtagcggccatagagaaacattgtgccaaattgacgggtgtgcattcgatagtgatagccctgctggcggccaaagccgaggtccgctacgagccggccaagatatccgcagcagccatcgccgactccatcaccgagctggggttcagctccgagctcatcagcgacagcggggcgccgaaggatttgaacctactaatcaagggcatgacctgtgcgtcgtgtgtcaacaagatagagaagtccctcatgaagctgaccggcgtggtgtcctgttccgtggcgctcaccaccagcaagggtaaagtcaagtatgaccccgaggtgatcggtgctcgccgcatctgtgatgctgtaggggacctcggcttcgaggccaacgtcgtgggatcgcagcacaaaggcaccgccaactatttggagcacaaagaagagatccgtcgttggcgtaacgcgttcctggtatccctgatattcggcgcgccgtgtatggcggccatgacttacttcatgctgggcatgggccatcactccgccagggacatgtgctgcgtgctgcctggactcagtctcgagaacctgctgctgtggctgctggcgacccccgtgcagtttatcggcggctggcacttctataaacaggcgtacaaagcgttgagacacgggacatcaaacatggatgtacttatatctatgaccactactataagttatttatattccgtgggcgcagtgagcgcggccatggcgctacagaaggacaccagcccgctcacgtttttcgacacgccgcccatgttactagtgttcgtgtcattaggcaggtggctagagcacatagctaagggtaagacttccgaggcgctatcaaagttgttatctctgaagcccacggaggctgttctcgtcaccctggaccctgaaggccgcgagatctcggagaagaacataccagtagacctggtggagaggggggacattctaaaggttgttccgggagcgaagatcccagtagacggaaaggtgatctccggccagagcacctgtgatgaatctctcataaccggggagtccatgccggtcgctaagaccaaagattccctggtgataggaggcagcatgaaccaacacggcgcgctgctggtgagggccactcacaccggcgaggccagcacactcgcacagatcgtgaggctggtggaggacgcgcagagcagcaaggcacccgtacagagactcgctgacactatcgcctcttacttcgtgccgatggtggtgttcctgtcgctgctgacgctggtctgctggaccatcagcggcgccctggacgtggacaggatcaaggctatcactccggagatctaccgcgacgcgggattctcggactgggagctgatagtgcaaacggccttccacttcgccctgtcggtgttggcgatagcctgtccctgtgcgctagggctcgccacgcccacggccgtcatggtggccacgggcgtgggcgcgcggctaggactgctcattaagggggcagagcctcttgagaacgctcacaaggtcaagacggtgatattcgacaagactggcaccgtcacgcgaggggacacgtccgtggcgagggtctccatactgacgggcgacccctccaccttaccggaagtcatcacgtgtatcctgacagcggaactgaacagcgaacatccggtcgcgtctgccatcgtgcggtggtgtacgagcgttgtgggctccccacgagcactcgtccgaggcttcacggcggctccggggtgcgggttgcgagcacgcgtgctcctgaccgagcgacccccgggactggacaaggatggagtcctgtcacatctggggggagtacccgtggagctggtgggaggggagggagacgccgcgctcagctccgcccaggccgctgccaggttacagagggtcatcaaggcggcggagcagggggaggaggtggagcaggtggtgcttatagggaacagagagtggatgcacaggaacggagtcatggtccctcgaagagtgcaggaacagctgcggacggacgaggagttagggaggacggctgtactggtcgccattaacgaccaactggtgtgcacgatcggcgtgtcggaccaggtgaagcccgaggcgcacctggccgtgtactgcctcaagaagatggggttggaggtgtgtctgctgacgggagacaacaagaagacggccgcggccatagcgagacaggtgggaatcaataaggtgttcgcggaagtgctgccctcacacaaggtggccaaggtccaggagttacaggacaaggggcagaaggtggctatggtgggtgacggtgtcaatgactccccggcgctggctcgagctgatgtcggtgtagccatcgccagcggtacggacgtggccgtggaagcagctgatttagtgcttatgaggagcgacctgctggacgtggtgtcgtgcctgcagctgtcgcgggtcacggtgcgccgcatcaggatgaacttcgtgttcgcttccgtctacaacctgctgggcatcccgctagccagcggagccttcgcgctctacggcctgcagctccagccgtggatggcgtccgctgctatggccatgagctcggtgtccgtggtgtgctccagcctcctgctgaagaccttcaggaagccgacgatggagcagctgaaaactccagagtatctccagtccttacaccaggaacagctggagcagctggaggcggtggcggttcaccgcggcctggacgagaagttggaccctcaggacaaaggcacgcctctggccaagttgttcacccgcagcaagtccaccgacgacttcctcctgcgcgaggaggacgacctgctgaccgtctccttcataccgaagaggtcgagctaggagcagctgtccacagctgacgtcacgttaccaatgttatgtacaaaatatatacctgatttatataaaaaatatattattatttggtatcgcaagtgaggctaacgtcgtggccgccgtctcaacccctacgggtatggtttctgttatctatgcccgtagcgagtg

//