GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-03-29 11:08:21, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_032442106            4724 bp    mRNA    linear   VRT 18-FEB-2020
DEFINITION  PREDICTED: Coturnix japonica ATPase copper transporting beta
            (ATP7B), transcript variant X6, mRNA.
ACCESSION   XM_032442106
VERSION     XM_032442106.1
DBLINK      BioProject: PRJNA314147
KEYWORDS    RefSeq.
SOURCE      Coturnix japonica (Japanese quail)
  ORGANISM  Coturnix japonica
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes;
            Phasianidae; Perdicinae; Coturnix.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_029516.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Coturnix japonica Annotation Release
                                           101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4724
                     /organism="Coturnix japonica"
                     /mol_type="mRNA"
                     /isolate="7356"
                     /db_xref="taxon:93934"
                     /chromosome="1"
                     /sex="male"
                     /tissue_type="blood"
                     /country="France: Tours, INRA PEAT"
     gene            1..4724
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 3 ESTs, 2 Proteins, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 8 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:107308183"
     CDS             237..4580
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X5"
                     /protein_id="XP_032297997.1"
                     /db_xref="GeneID:107308183"
                     /translation="
MERKLDNKTRRELSCLATLNNKNITLVSIRKRQAAHDVPELLIIEGSKAGSPLEASSNLQKEEKVLQRNSMGMPEGNATGRQVLSNADSPPSCALESEMKQNFAFDNMGYEENCEAMPSSSSQERTVVVNVVGMTCQSCVQSVEGRISKVKGVVSIKVSLELNNALVKYLQSEISPEQICQEIEDMGFDANIAEERLTPVSVNLPCSREAVIKLRIEGMTCQSCVTSIEGKIKKLHGVAKIKVSLSNQEAVIAYHPYIIQPEELRSHISNLGYDCTIKSKSAPLKLGVLDVRSLQSADPKETPASLEGEGLHPLVANKSSTATVTVHIEGMHCKSCVRNIEGNISSLPGIQSIEVSLEHKWAVVQYSPNLITLPALQQAIESLPPGNFKVYLPNSSEANNQASSSPALVCDLFREPLKDTVCTAVIRIDGMTCNSCVQSIEGTISQRQGVQHVAVSLADKTGTIHYDPANTNGEELRAAIEEMGFDASLLTDTGAGDHKQWPDASNAAAQPRAPEPPRQSCVSDALPDSPHLDEPNQPSGATAKKCFLQITGMTCASCVSTIERNLQKEDGIVSVLVALMAGKAEIKYKPEFIQPLEIAQLIQNLGFEATVIEDHSETEGNVELLITGMTCASCVHNIESKLMRMNGIFYASVALATCKAHIQFDPEITGPRDIIKIIEEIGFHASVSRRVPNTHNLDHKREIQQWRKSFLCSLVFGIPVLILMIYMLIPGGEHHGAMVLEQNLIPGLSILNLLFFVLCTFVQFLGGWYFYVQAYKSLKHKAANMDVLIVLATTIAYVYSCVILLVAIIEKAEKSPVTFFDTPPMLFVFIALGRWLEHIAKSKTSEALAKLISLQATEATVVTLGPDHSIIREEQVPVELVQRGDIVKVVPGGKFPVDGKVIEGNSMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVNATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLVAWITIGFINFDIIQKYFPNQNKHLSKAELILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITCGVPKVMRVLLLEDTAVLCLKKVLAVVGTAEASSEHPLGVAVTKYCKEELGTESLGYCTNFQAVPGCGISCKVGGVEAVLGMAEEGVDKLDTNKSGDSSAPLGDNALIALSESNGSSSSHIYSVLIGNREWMRRNGLHIANDVNDAMTDHETKGQTAILVAIDGALCGMIAIADTVKQEAALAVHTLKNMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNGRRKVAMVGDGVNDSPALARADIGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLILALIYNLLGIPIAAGVFMPAGLVLQPWMGSAAMAASSVSVVLSSLQLKWQVIIH"
     misc_feature    618..806
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(636..644,651..653)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    873..1064
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(891..899,906..908)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1218..1385
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1227..1235,1242..1244)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1509..1700
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1527..1535,1542..1544)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1878..2066
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1893..1901,1908..1910)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2103..2294
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(2121..2129,2136..2138)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2358..4499
                     /gene="ATP7B"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(3351..3353,3357..3359,4428..4430)
                     /gene="ATP7B"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(3483..3491,3693..3695,3879..3887,3975..3977,
                     4095..4103,4161..4163,4170..4172,4179..4181,4236..4238,
                     4245..4247)
                     /gene="ATP7B"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      
ttggtgggaagcattgaaactggcagcgagaggaggtagccgagtgcagcgagcagtgtacacaaagatcacaggttacatctgggatttcgttatgcatgcctaatgagcacactgatgagaactccccaggccgttgtaaaagtagctgaaaaaagagctgctgataaggcactgaatagcttcactcctaaagctttcctttggcgtggggatatttaaagccagcaaagataatggagagaaaattggacaataaaacgcgaagggagctgtcctgcctcgctactttaaacaacaaaaacataacgctggtgtccattcgaaagcggcaggcagctcacgatgtgcctgaactactgattattgaagggtccaaagcagggtctccgctagaagcaagcagtaacttgcagaaagaagagaaagttttgcagcgtaactccatgggaatgccagaaggcaacgcaactggaaggcaggttttgtccaacgctgactctcctccgagctgtgcgctggaatctgaaatgaaacagaactttgcttttgacaacatgggctacgaggagaactgtgaagccatgccctcatcgtcttcccaggagcgcactgtggtggtcaatgttgtaggaatgacttgccaatcttgtgtgcagtcggtagaaggacgaatttccaaagttaagggtgttgtgagtattaaagtctcccttgaactgaataatgctctagtaaaatatctacagtcagaaataagccctgaacagatttgccaagaaatagaggatatgggctttgatgctaacatagcagaagagaggttgacaccagtgtctgtaaatttgccgtgctcgagagaggcagtaataaagcttcggatagaaggcatgacgtgccagtcctgcgtcaccagcattgaaggaaagattaagaagcttcacggtgtggcaaaaatcaaggtgtcactcagtaaccaggaagcagttattgcttaccatccgtatatcattcagcctgaggaacttaggagccatatcagtaacctggggtacgactgcaccattaagagtaaatcggcacctttgaagcttggtgtgcttgatgtcaggagcctgcagagtgcagaccccaaagagacacctgcatctctcgagggtgagggtttgcatccattggttgccaacaagagcagcacagctacagtgactgtacatatagaaggcatgcactgcaaatcttgtgtcagaaacattgaaggaaatatatcctctcttccaggcatacaaagtattgaagtctccttggagcataaatgggctgtcgtgcaatatagcccaaatttaataaccttgcctgctttgcagcaagctattgaatcccttccacctggaaactttaaagtttacctccctaatagttcagaagcaaataatcaagcatcttcgtctcctgctttggtatgtgatctcttcagagagccactgaaagacacagtgtgcacagctgttattaggattgatggcatgacctgcaattcctgtgtacagtccatagaaggaacaatatctcagagacaaggcgtgcagcatgtagcagtttctttagctgacaagactgggaccatacattatgatccagctaacacaaatggagaggaactgagagctgccatagaagaaatggggtttgatgcatctttgctgacagatactggtgcaggagatcacaagcagtggcctgatgccagcaatgctgcagcacagcctcgagctccagagcctcctcgccagagctgtgtctccgatgcacttccagacagcccgcaccttgatgagccaaaccagcccagtggagcaacagccaagaagtgctttttacaaatcactggcatgacctgtgcatcgtgtgtgtctaccattgaaagaaatctgcagaaagaagacggtattgtttcagtgttggtagcactgatggcaggtaaagcagagataaaatacaagccagagttcatacagcctcttgaaatagcacagttgattcagaatttgggttttgaagccactgtcatagaagatcattcagaaacagaaggaaatgtggagcttcttattacagggatgacttgtgcttcctgtgttcacaacattgaatccaaacttatgaggatgaatggcatattctacgcctcagttgcacttgctacttgcaaagctcacatccagtttgatcctgaaattacaggacctcgagatattataaaaataatcgaggaaattggctttcatgcttctgtgtctagaagagttccaaatacgcataacttggatcataaaagggagatacagcagtggaggaagtctttcttgtgcagccttgtgtttggtattcctgtcttaatcctaatgatttatatgctaatacctggcggcgaacaccacggggctatggtgctggagcagaatctcattcctggattatctattttaaatcttctcttctttgtcctgtgcacttttgttcagtttctcggtggatggtatttttatgtacaagcttacaagtcactgaagcacaaggcagccaacatggacgtgcttatcgtactggccacaacgattgcttatgtgtattcatgtgtgatcctgttggtggcaataattgaaaaggcagagaaaagccctgtcactttctttgacactcctccaatgttgtttgtattcattgcccttgggagatggcttgaacatatagcaaagagtaaaacctcagaagctcttgctaaacttatatctctccaagccacggaagccactgtggtgactctaggacctgaccactctatcatcagagaggagcaggtacctgttgaactggttcaaaggggtgatattgtaaaggttgttccaggtgggaagttcccagtggatgggaaggtcattgaaggcaattctatggcagatgagtctctcattactggggaagctatgcctgttactaaaaagcctggaagcacagtgattgctggctctataaatgcacatggctcagttcttgttaatgcaactcatgttggtaatgataccaccctagcacagatcgtgaaattggtggaagaagctcaaatgtcaaaggcaccaatccagcaactggcagataagtttagtggatattttgttccatttatcatcataatttctacagtgactttggtagcatggatcacaatcggctttataaattttgatattattcagaagtattttcctaatcagaacaagcacctttcaaaagctgaactaatactgaggtttgcgtttcaaacctcaatcactgtgctgagcattgcatgcccctgttctttaggcttggctaccccaacagctgtgatggtgggcacaggagttgctgcacagaatggtattctcatcaaaggtggaaaacccctggaaatggcacacaagatcaaaactgtgatgtttgataaaacggggaccattacttgtggggttcctaaagtcatgagggttcttctgctggaagacacagctgtgctctgtctgaagaaggtactggcagtggttggcactgcagaagccagcagtgagcatcctttgggagtggcagtcactaaatactgcaaagaggagcttggcactgagagccttggatactgcaccaacttccaggcagtcccaggctgtggcatcagctgcaaagtaggtggtgttgaggctgtcctgggcatggctgaggaaggtgttgataagttggacactaacaagagtggggacagcagtgctcctctgggagataacgcactgattgcactctctgaatcaaatggttcatcgtcttcccatatatactcagtattgattggaaatcgtgagtggatgcgacggaatggcttgcatattgcaaatgatgtcaatgatgccatgacagaccatgaaacaaaaggacagacagccatattagtggctatagatggcgccttgtgtggaatgatcgcaattgcagacacggtcaagcaggaggcagcccttgctgtgcacacgctgaaaaacatgggaatagatgtggtgctgataacgggagacaacaggaaaactgcaaaagccattgctactcaggttgggatcaaaaaagtctttgctgaggttcttccttctcacaaagtcgcaaaggtccaagaactccaaaatgggaggagaaaggttgcaatggttggtgacggagtcaatgattcccctgcactagccagggccgacattggaatagcaattggaacgggcactgatgttgccattgaagcagcagatgttgttcttatccgaaatgacttgctggatgtagttgccagtattcacttatcgaagagaacagtgcggagaatacgaataaatctgattctcgccttaatttataatctgcttggaataccaatagcagcaggtgtgtttatgcccgctggtcttgtgcttcagccttggatgggatcagctgccatggcagcttcctctgtgtctgttgtgctgtcttccctgcagctaaaatggcaagttatcatacactaagtaatgaggaaacacagacagctctgctgctgggatttaattataagaagccagacacagaaagttatgaagctcaagctcaaggccgcatgaagccactaactccttcccaaatcagtgttcatattggaatggatgatagga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]