2024-03-29 11:08:21, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_032442106 4724 bp mRNA linear VRT 18-FEB-2020 DEFINITION PREDICTED: Coturnix japonica ATPase copper transporting beta (ATP7B), transcript variant X6, mRNA. ACCESSION XM_032442106 VERSION XM_032442106.1 DBLINK BioProject: PRJNA314147 KEYWORDS RefSeq. SOURCE Coturnix japonica (Japanese quail) ORGANISM Coturnix japonica Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Perdicinae; Coturnix. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_029516.1) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Coturnix japonica Annotation Release 101 Annotation Version :: 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.3 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..4724 /organism="Coturnix japonica" /mol_type="mRNA" /isolate="7356" /db_xref="taxon:93934" /chromosome="1" /sex="male" /tissue_type="blood" /country="France: Tours, INRA PEAT" gene 1..4724 /gene="ATP7B" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 8 samples with support for all annotated introns" /db_xref="GeneID:107308183" CDS 237..4580 /gene="ATP7B" /codon_start=1 /product="copper-transporting ATPase 2 isoform X5" /protein_id="XP_032297997.1" /db_xref="GeneID:107308183" /translation="
MERKLDNKTRRELSCLATLNNKNITLVSIRKRQAAHDVPELLIIEGSKAGSPLEASSNLQKEEKVLQRNSMGMPEGNATGRQVLSNADSPPSCALESEMKQNFAFDNMGYEENCEAMPSSSSQERTVVVNVVGMTCQSCVQSVEGRISKVKGVVSIKVSLELNNALVKYLQSEISPEQICQEIEDMGFDANIAEERLTPVSVNLPCSREAVIKLRIEGMTCQSCVTSIEGKIKKLHGVAKIKVSLSNQEAVIAYHPYIIQPEELRSHISNLGYDCTIKSKSAPLKLGVLDVRSLQSADPKETPASLEGEGLHPLVANKSSTATVTVHIEGMHCKSCVRNIEGNISSLPGIQSIEVSLEHKWAVVQYSPNLITLPALQQAIESLPPGNFKVYLPNSSEANNQASSSPALVCDLFREPLKDTVCTAVIRIDGMTCNSCVQSIEGTISQRQGVQHVAVSLADKTGTIHYDPANTNGEELRAAIEEMGFDASLLTDTGAGDHKQWPDASNAAAQPRAPEPPRQSCVSDALPDSPHLDEPNQPSGATAKKCFLQITGMTCASCVSTIERNLQKEDGIVSVLVALMAGKAEIKYKPEFIQPLEIAQLIQNLGFEATVIEDHSETEGNVELLITGMTCASCVHNIESKLMRMNGIFYASVALATCKAHIQFDPEITGPRDIIKIIEEIGFHASVSRRVPNTHNLDHKREIQQWRKSFLCSLVFGIPVLILMIYMLIPGGEHHGAMVLEQNLIPGLSILNLLFFVLCTFVQFLGGWYFYVQAYKSLKHKAANMDVLIVLATTIAYVYSCVILLVAIIEKAEKSPVTFFDTPPMLFVFIALGRWLEHIAKSKTSEALAKLISLQATEATVVTLGPDHSIIREEQVPVELVQRGDIVKVVPGGKFPVDGKVIEGNSMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVNATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLVAWITIGFINFDIIQKYFPNQNKHLSKAELILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITCGVPKVMRVLLLEDTAVLCLKKVLAVVGTAEASSEHPLGVAVTKYCKEELGTESLGYCTNFQAVPGCGISCKVGGVEAVLGMAEEGVDKLDTNKSGDSSAPLGDNALIALSESNGSSSSHIYSVLIGNREWMRRNGLHIANDVNDAMTDHETKGQTAILVAIDGALCGMIAIADTVKQEAALAVHTLKNMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNGRRKVAMVGDGVNDSPALARADIGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLILALIYNLLGIPIAAGVFMPAGLVLQPWMGSAAMAASSVSVVLSSLQLKWQVIIH"
misc_feature 618..806 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(636..644,651..653) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 873..1064 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(891..899,906..908) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1218..1385 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1227..1235,1242..1244) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1509..1700 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1527..1535,1542..1544) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1878..2066 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1893..1901,1908..1910) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 2103..2294 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(2121..2129,2136..2138) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 2358..4499 /gene="ATP7B" /note="P-type heavy metal-transporting ATPase, similar to human copper-transporting ATPases, ATP7A and ATP7B; Region: P-type_ATPase_Cu-like; cd02094" /db_xref="CDD:319783" misc_feature order(3351..3353,3357..3359,4428..4430) /gene="ATP7B" /note="putative Cu binding site [ion binding]; other site" /db_xref="CDD:319783" misc_feature order(3483..3491,3693..3695,3879..3887,3975..3977, 4095..4103,4161..4163,4170..4172,4179..4181,4236..4238, 4245..4247) /gene="ATP7B" /note="putative ATP binding site [chemical binding]; other site" /db_xref="CDD:319783" ORIGIN
ttggtgggaagcattgaaactggcagcgagaggaggtagccgagtgcagcgagcagtgtacacaaagatcacaggttacatctgggatttcgttatgcatgcctaatgagcacactgatgagaactccccaggccgttgtaaaagtagctgaaaaaagagctgctgataaggcactgaatagcttcactcctaaagctttcctttggcgtggggatatttaaagccagcaaagataatggagagaaaattggacaataaaacgcgaagggagctgtcctgcctcgctactttaaacaacaaaaacataacgctggtgtccattcgaaagcggcaggcagctcacgatgtgcctgaactactgattattgaagggtccaaagcagggtctccgctagaagcaagcagtaacttgcagaaagaagagaaagttttgcagcgtaactccatgggaatgccagaaggcaacgcaactggaaggcaggttttgtccaacgctgactctcctccgagctgtgcgctggaatctgaaatgaaacagaactttgcttttgacaacatgggctacgaggagaactgtgaagccatgccctcatcgtcttcccaggagcgcactgtggtggtcaatgttgtaggaatgacttgccaatcttgtgtgcagtcggtagaaggacgaatttccaaagttaagggtgttgtgagtattaaagtctcccttgaactgaataatgctctagtaaaatatctacagtcagaaataagccctgaacagatttgccaagaaatagaggatatgggctttgatgctaacatagcagaagagaggttgacaccagtgtctgtaaatttgccgtgctcgagagaggcagtaataaagcttcggatagaaggcatgacgtgccagtcctgcgtcaccagcattgaaggaaagattaagaagcttcacggtgtggcaaaaatcaaggtgtcactcagtaaccaggaagcagttattgcttaccatccgtatatcattcagcctgaggaacttaggagccatatcagtaacctggggtacgactgcaccattaagagtaaatcggcacctttgaagcttggtgtgcttgatgtcaggagcctgcagagtgcagaccccaaagagacacctgcatctctcgagggtgagggtttgcatccattggttgccaacaagagcagcacagctacagtgactgtacatatagaaggcatgcactgcaaatcttgtgtcagaaacattgaaggaaatatatcctctcttccaggcatacaaagtattgaagtctccttggagcataaatgggctgtcgtgcaatatagcccaaatttaataaccttgcctgctttgcagcaagctattgaatcccttccacctggaaactttaaagtttacctccctaatagttcagaagcaaataatcaagcatcttcgtctcctgctttggtatgtgatctcttcagagagccactgaaagacacagtgtgcacagctgttattaggattgatggcatgacctgcaattcctgtgtacagtccatagaaggaacaatatctcagagacaaggcgtgcagcatgtagcagtttctttagctgacaagactgggaccatacattatgatccagctaacacaaatggagaggaactgagagctgccatagaagaaatggggtttgatgcatctttgctgacagatactggtgcaggagatcacaagcagtggcctgatgccagcaatgctgcagcacagcctcgagctccagagcctcctcgccagagctgtgtctccgatgcacttccagacagcccgcaccttgatgagccaaaccagcccagtggagcaacagccaagaagtgctttttacaaatcactggcatgacctgtgcatcgtgtgtgtctaccattgaaagaaatctgcagaaagaagacggtattgtttcagtgttggtagcactgatggcaggtaaagcagagataaaatacaagccagagttcatacagcctcttgaaatagcacagttgattcagaatttgggttttgaagccactgtcatagaagatcattcagaaacagaaggaaatgtggagcttcttattacagggatgacttgtgcttcctgtgttcacaacattgaatccaaacttatgaggatgaatggcatattctacgcctcagttgcacttgctacttgcaaagctcacatccagtttgatcctgaaattacaggacctcgagatattataaaaataatcgaggaaattggctttcatgcttctgtgtctagaagagttccaaatacgcataacttggatcataaaagggagatacagcagtggaggaagtctttcttgtgcagccttgtgtttggtattcctgtcttaatcctaatgatttatatgctaatacctggcggcgaacaccacggggctatggtgctggagcagaatctcattcctggattatctattttaaatcttctcttctttgtcctgtgcacttttgttcagtttctcggtggatggtatttttatgtacaagcttacaagtcactgaagcacaaggcagccaacatggacgtgcttatcgtactggccacaacgattgcttatgtgtattcatgtgtgatcctgttggtggcaataattgaaaaggcagagaaaagccctgtcactttctttgacactcctccaatgttgtttgtattcattgcccttgggagatggcttgaacatatagcaaagagtaaaacctcagaagctcttgctaaacttatatctctccaagccacggaagccactgtggtgactctaggacctgaccactctatcatcagagaggagcaggtacctgttgaactggttcaaaggggtgatattgtaaaggttgttccaggtgggaagttcccagtggatgggaaggtcattgaaggcaattctatggcagatgagtctctcattactggggaagctatgcctgttactaaaaagcctggaagcacagtgattgctggctctataaatgcacatggctcagttcttgttaatgcaactcatgttggtaatgataccaccctagcacagatcgtgaaattggtggaagaagctcaaatgtcaaaggcaccaatccagcaactggcagataagtttagtggatattttgttccatttatcatcataatttctacagtgactttggtagcatggatcacaatcggctttataaattttgatattattcagaagtattttcctaatcagaacaagcacctttcaaaagctgaactaatactgaggtttgcgtttcaaacctcaatcactgtgctgagcattgcatgcccctgttctttaggcttggctaccccaacagctgtgatggtgggcacaggagttgctgcacagaatggtattctcatcaaaggtggaaaacccctggaaatggcacacaagatcaaaactgtgatgtttgataaaacggggaccattacttgtggggttcctaaagtcatgagggttcttctgctggaagacacagctgtgctctgtctgaagaaggtactggcagtggttggcactgcagaagccagcagtgagcatcctttgggagtggcagtcactaaatactgcaaagaggagcttggcactgagagccttggatactgcaccaacttccaggcagtcccaggctgtggcatcagctgcaaagtaggtggtgttgaggctgtcctgggcatggctgaggaaggtgttgataagttggacactaacaagagtggggacagcagtgctcctctgggagataacgcactgattgcactctctgaatcaaatggttcatcgtcttcccatatatactcagtattgattggaaatcgtgagtggatgcgacggaatggcttgcatattgcaaatgatgtcaatgatgccatgacagaccatgaaacaaaaggacagacagccatattagtggctatagatggcgccttgtgtggaatgatcgcaattgcagacacggtcaagcaggaggcagcccttgctgtgcacacgctgaaaaacatgggaatagatgtggtgctgataacgggagacaacaggaaaactgcaaaagccattgctactcaggttgggatcaaaaaagtctttgctgaggttcttccttctcacaaagtcgcaaaggtccaagaactccaaaatgggaggagaaaggttgcaatggttggtgacggagtcaatgattcccctgcactagccagggccgacattggaatagcaattggaacgggcactgatgttgccattgaagcagcagatgttgttcttatccgaaatgacttgctggatgtagttgccagtattcacttatcgaagagaacagtgcggagaatacgaataaatctgattctcgccttaatttataatctgcttggaataccaatagcagcaggtgtgtttatgcccgctggtcttgtgcttcagccttggatgggatcagctgccatggcagcttcctctgtgtctgttgtgctgtcttccctgcagctaaaatggcaagttatcatacactaagtaatgaggaaacacagacagctctgctgctgggatttaattataagaagccagacacagaaagttatgaagctcaagctcaaggccgcatgaagccactaactccttcccaaatcagtgttcatattggaatggatgatagga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]