LOCUS       XM_032314180            5141 bp    mRNA    linear   MAM 03-FEB-2020
DEFINITION  PREDICTED: Mustela erminea ATPase copper transporting beta (ATP7B),
            transcript variant X5, mRNA.
ACCESSION   XM_032314180
VERSION     XM_032314180.1
DBLINK      BioProject: PRJNA602914
KEYWORDS    RefSeq.
SOURCE      Mustela erminea (ermine)
  ORGANISM  Mustela erminea
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Carnivora; Caniformia;
            Musteloidea; Mustelidae; Mustelinae; Mustela.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_045628.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Mustela erminea Annotation Release
                                           100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..5141
                     /organism="Mustela erminea"
                     /mol_type="mRNA"
                     /isolate="mMusErm1"
                     /db_xref="taxon:36723"
                     /chromosome="15"
                     /sex="male"
                     /tissue_type="spleen (genome), liver, muscle, kidney"
                     /dev_stage="adult"
                     /country="New Zealand: Coromandel"
                     /lat_lon="37.304717 S 175.755071 E"
                     /collected_by="Andrew Veale, Tim Cruickshank"
     gene            1..5141
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 8 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 11 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:116573862"
     CDS             314..4612
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X4"
                     /protein_id="XP_032170071.1"
                     /db_xref="GeneID:116573862"
                     /translation="

MKQSFAFDNVGYEGGLDTVDPPQTATGTISISGMTCQSCVKSIEGRISSLKGIVSIKVSLEQGSATVRYVPSILSLPQICRHIEDMGFEASVAEGKAASWPSRSSPGLEAVVKLRVEGMTCQSCVSSIEGKLGKLQGVVRVRVSLSTQEAVITYQPYLIQPQDLRDHVSDMGFEAVIKNKVAPVSLGPIDIGRLQSTNPKTPLASDNQSLNNSETSEHQGSHTVTLQLRVDGMHCTSCVMNIEENIGQLPGVQSVQVSLESRLAQVQYDPSRVTATALQRAIEALPPGNFKVSLPDGVTGNGTGRRSSNRVVPAPTLRPQVQGVCDTVVLAIAGMTCASCAQSIEGLISQREGVQRISVSVADGTGVVLYDPSVTNPEELRAAVEEMGFEASVISENYSTNHVGNHSAGTSPAPPEAGVPVFVQEVAPRAGEPPKNHNSGSSSEPPQASTTVAPQKCFLQIGGMTCASCVSHIEKSLQKEAGILSVLVALMAGKAEVKYNPEVIQPLEIAQLIQDMGFEATVMEDYTGSDGDLELIITGMTCASCVHNIESRLTRTNGITYASVALATSKAHVKFDPEIIGPRDIVRIIEEIGFHASPAQRNSGAHHLDHKVEIKQWRKSFLCSLVFGIPVMGLMIYMLVPSHEPHEAMVLDRNIIPGLSILNLIFFILCTFVQLLGGWYFYVQAYRSLKHGTANMDVLIVLATTIAYTYSFVILVVAVAEKAERSPVTFFDTPPMLFVFIALGRWLEHVAKSKTSEALARLMSLQATEAIVVTLGEDNLIVREEQVPMELVQRGDVIKVVPGGKFPVDGKILEGNTMVDESLITGEAMPVTKKPGSIVIAGSINAHGSVLVNATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADRFSGYFVPFIIIISTLTLVVWIIIGFIDFGVVQKYFPTHSKHISQAEVIIRFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITHGVPKVMRVLLLVDVAMMPLRKVLAVVGTAEASSEHPLGVAITKYCKEELGTDSLGYCTDFQAVPGCGIGCKVSSVEGLLAHSESQQSKQAAPPSRAGSAPEEIDVTPQTFSVLIGNREWMRRNGLTISSDVSDAMANHELKGQTAVLVAVDGVLCAMIAIADAVKQEAALAVHTLKSMGVDVVLITGDNRKTARAIATQVGINKVFAEVLPSHKVAKVQELQNEGKKVAMVGDGINDSPALAQADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVWRIHLNLVLALIYNLIGIPIAAGVFMPIGIVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDLERYEAQAQGRMKPLTASQVSVYIGMDDRRRDSPRATPWDQVSFISQVSLSSLKSDKLSRHSAAADDGGDKWSLLLNDRDEEQCI"

     misc_feature    395..586
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(413..421,428..430)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    650..838
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(668..676,683..685)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    992..1168
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1010..1018,1025..1027)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1298..1489
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1316..1324,1331..1333)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1688..1876
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1703..1711,1718..1720)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1913..2104
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1931..1939,1946..1948)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2168..4276
                     /gene="ATP7B"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(3161..3163,3167..3169,4205..4207)
                     /gene="ATP7B"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(3293..3301,3503..3505,3656..3664,3752..3754,
                     3872..3880,3938..3940,3947..3949,3956..3958,4013..4015,
                     4022..4024)
                     /gene="ATP7B"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      

tgtggtctgaccccacggggctcagggggtctgcatttggaacaggtgcctatggttgttaaatttaagccctcctatgagaatgtatggacagccctggaagagagacagaattaaagtgttgcccaatggacataagtgcattgcggcaggatccaaagtgtgcagggagatttcaggagacccccacaggtgggccagccacactacgcttgttccagccacaccacgcttatttcttcctgagagaagcctgcacttcttctagatcttgtctaaactttccttgcccgctcgtgcccgggagccagcgatgaagcagagttttgcctttgacaatgtcggctacgaaggcggcctggacactgtggacccccctcagacggccaccggcaccatcagcatttcgggcatgacttgccagtcatgtgtaaagtctatcgagggcaggatttccagcctgaaaggcatcgtgagcattaaggtttccctggaacagggcagtgcgacggtgaggtatgtgccgtccatcctgagcctgccgcagatttgccgtcacattgaggacatgggctttgaggccagcgttgcagagggaaaggctgcctcctggccttcgaggtcctcgcctggcctcgaggctgtggtcaagcttcgggtggaaggcatgacctgccagtcctgcgtcagctccatcgaaggcaagctcgggaaactgcagggagtagtgagagtccgagtgtccctcagcacccaggaggcagttattacataccagccttacctgattcagccccaggacctcagggaccacgtcagtgacatgggctttgaagctgtcatcaagaacaaagtggcgcccgtaagcctgggacccatcgatatcgggcgcttacagagcaccaatccaaagacccctttggcatctgataaccagtctctcaataactctgagacctcagagcaccaagggagccacacggtcaccctgcaactgagagtagatggaatgcactgtacgtcttgtgtcatgaatattgaagaaaacataggccagctgcccggggttcaaagtgttcaagtgtccttggagagcagactggcccaagtacagtatgacccttctcgcgtcaccgccaccgccctgcagagggccatcgaagcgcttccacctgggaacttcaaagtctctcttcctgatggtgtgacaggaaatgggacaggtcgcaggtcttccaaccgtgttgtccctgcccccacgctgagaccccaggtgcagggggtgtgcgatactgtggtgctcgccattgctggcatgacctgtgcgtcctgtgcccagtccatcgaaggcctcatctcccaaagggaaggggtacagcggatatcggtctctgtggctgacgggactggcgtggttctctatgatccgtctgttactaacccggaagaactccgagctgctgttgaagaaatgggatttgaggcttcagtcatttctgaaaactattccaccaaccatgttggaaaccacagtgcggggacttccccagcgccccccgaagctggcgttcctgtgtttgtacaggaagtggctccccgtgccggggagccccctaaaaaccacaactccggctcctcgtccgagcccccacaggcctctaccacggtggctccccagaagtgctttctacagattggaggcatgacctgtgcatcctgtgtgtcccacatagagaagagcctgcagaaggaagcaggtattctgtcagtgctggttgccctcatggctgggaaggcagaggtcaagtataacccagaagtcatccagcccctggagatagctcagctcatccaggacatgggctttgaggcgacagtaatggaagactacacaggctccgatggcgacctcgaactcatcatcacggggatgacctgtgcgtcctgtgttcacaacattgagtccagactcacaaggacaaacggcatcacttacgcctctgtggcccttgccaccagcaaagcccacgtgaaatttgatcctgaaattatcggtccacgggatattgtccgaattatcgaggaaatcggctttcatgcttccccggcccagagaaactccggcgcgcatcacttggaccacaaggtggaaataaagcagtggaggaagtctttcctgtgcagcctggtgttcggcatccccgtcatgggtctcatgatctacatgctggtgcccagccatgagccccacgaggccatggtcctggaccgcaacatcattccgggactgtccatcctcaatctcatcttctttatcttgtgtacctttgtccagctcctcggtgggtggtacttctacgtccaggcctacaggtctctgaagcatgggacagccaacatggacgtgctcatcgtgctggctaccaccatcgcctacacctactcatttgtcatcctagtggtggccgtagccgagaaggcggagaggagccccgtgaccttcttcgacaccccccccatgctctttgtgttcattgccctggggcggtggctggaacacgtggcaaagagcaaaacctcagaagcccttgccagactcatgtctctccaagccacagaagccatcgttgtcacccttggtgaggacaacttgattgtcagggaggagcaggtgcccatggagctggtgcagcggggcgacgtcatcaaggttgtccccggggggaagttcccagtggatgggaaaatcttggaaggcaacaccatggtggacgagtccctcatcacaggagaagccatgcctgtcacgaagaaacctggaagcatagtgattgctgggtctataaatgcacatggctctgtactcgttaatgccactcacgtgggcaatgacaccacattggctcagatcgtgaaattggtagaagaggctcagatgtcaaaggcacccattcagcaactggctgaccggtttagtgggtattttgtcccatttatcatcatcatttcaacgctgacgttggtggtatggattataatcggttttatcgattttggtgttgttcagaaatactttcctacccacagcaagcacatctcccaggcagaggtgatcatccggtttgcgttccagacgtccatcaccgtgctgtgcatcgcctgcccctgctccctgggcctggccacgcccacagcggtcatggtgggcaccggggtggccgcccagaatggcatcctcatcaaaggaggcaagcctctggagatggcccacaagataaagaccgtgatgtttgacaaaactggcaccatcacccatggggtccccaaagtcatgagggtcctcctgctcgtggatgtggccatgatgcccctcaggaaggttcttgctgtggtggggactgcagaggccagcagcgagcaccccttgggcgtggcaatcaccaagtactgtaaagaggaattgggaaccgactccttgggatactgcacggacttccaagcagtgcccggctgtggaatcggctgcaaagtcagtagtgtggagggcctcctggcccacagcgagagccagcagagcaaacaggcggctcccccgagcagggctggcagcgctcccgaggaaatagacgtgaccccccagaccttctctgtgctcatcgggaaccgcgaatggatgaggcgcaacggcctaaccatttccagcgacgtcagtgacgcgatggcgaatcatgagctgaaaggccagacggccgtgctggtggccgttgacggcgtgctctgtgccatgatcgccatcgccgacgcagtcaagcaggaggcagccctggccgtgcacacgctgaagagtatgggtgtggacgtggttctgatcacaggggacaaccggaagacggccagagccatcgccacccaggttggtatcaacaaagtctttgcagaggtgctaccttctcacaaggtggccaaggtccaggagctccagaatgaagggaagaaagttgccatggtaggagacgggattaatgactcgccggccttggcccaggctgatgtgggcattgccatcgggacaggcacggatgtcgccatcgaggctgctgacgttgtcctcattagaaacgatttgctcgatgtggtggctagcattcacctctccaagaggaccgtctggagaatacacctcaacctggtgctggcgttgatttataacctgatcggaatacccatcgcggcaggggtcttcatgcccatcggcatcgtgctgcagccgtggatgggctcggcggccatggcggcctcctctgtgtctgtggttctctcgtcgctgcagctcaagtgctataagaagcctgacctggagcggtatgaggcccaggcccagggccgcatgaagcccctgacagcgtcgcaggtgagcgtgtacatcggcatggatgaccggcggcgggactccccgagggccacaccctgggaccaggtcagcttcatcagccaggtgtctctgtcctccctgaagtccgacaagctgtctcgacacagtgctgcggctgatgatggtggggacaagtggtctctgctcctgaacgacagagatgaggagcagtgcatctgaaagctgcaggcgggtggagacccaggggtctgtctcctcactgagtagctggtccggcttccccggggaccgaggctcaggccgaacaggcacagctccagcggcaagatgggcgaagctcccctccagccctggggacttccactccctcctggagatggctggtcatccctcctagcatgggcggtgcccctatgtggctcctgggtcacccacctccccgtccccactgggatcccagcggcacaggggccaggcttcccggcctgaccatgctgtgggcctgggcttgtcgggaaccttgctggactctagcagagcagaggacggccagccttcctcacaggcctctgctttagtgtttggaacgactacttgtaaaaagaggaaaatctcatcgggaccaaaaacttagctgggcctttcctcacgagaagcctcgtgttgggttctttttgacaacacccacatgattgcgtatctgagaccacagtttacctcaaatacaccccactgatgtctgccggca

//