LOCUS       XM_032314179            5356 bp    mRNA    linear   MAM 03-FEB-2020
DEFINITION  PREDICTED: Mustela erminea ATPase copper transporting beta (ATP7B),
            transcript variant X4, mRNA.
ACCESSION   XM_032314179
VERSION     XM_032314179.1
DBLINK      BioProject: PRJNA602914
KEYWORDS    RefSeq.
SOURCE      Mustela erminea (ermine)
  ORGANISM  Mustela erminea
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Carnivora; Caniformia;
            Musteloidea; Mustelidae; Mustelinae; Mustela.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_045628.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Mustela erminea Annotation Release
                                           100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..5356
                     /organism="Mustela erminea"
                     /mol_type="mRNA"
                     /isolate="mMusErm1"
                     /db_xref="taxon:36723"
                     /chromosome="15"
                     /sex="male"
                     /tissue_type="spleen (genome), liver, muscle, kidney"
                     /dev_stage="adult"
                     /country="New Zealand: Coromandel"
                     /lat_lon="37.304717 S 175.755071 E"
                     /collected_by="Andrew Veale, Tim Cruickshank"
     gene            1..5356
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 8 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 43 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:116573862"
     CDS             529..4827
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X4"
                     /protein_id="XP_032170070.1"
                     /db_xref="GeneID:116573862"
                     /translation="

MKQSFAFDNVGYEGGLDTVDPPQTATGTISISGMTCQSCVKSIEGRISSLKGIVSIKVSLEQGSATVRYVPSILSLPQICRHIEDMGFEASVAEGKAASWPSRSSPGLEAVVKLRVEGMTCQSCVSSIEGKLGKLQGVVRVRVSLSTQEAVITYQPYLIQPQDLRDHVSDMGFEAVIKNKVAPVSLGPIDIGRLQSTNPKTPLASDNQSLNNSETSEHQGSHTVTLQLRVDGMHCTSCVMNIEENIGQLPGVQSVQVSLESRLAQVQYDPSRVTATALQRAIEALPPGNFKVSLPDGVTGNGTGRRSSNRVVPAPTLRPQVQGVCDTVVLAIAGMTCASCAQSIEGLISQREGVQRISVSVADGTGVVLYDPSVTNPEELRAAVEEMGFEASVISENYSTNHVGNHSAGTSPAPPEAGVPVFVQEVAPRAGEPPKNHNSGSSSEPPQASTTVAPQKCFLQIGGMTCASCVSHIEKSLQKEAGILSVLVALMAGKAEVKYNPEVIQPLEIAQLIQDMGFEATVMEDYTGSDGDLELIITGMTCASCVHNIESRLTRTNGITYASVALATSKAHVKFDPEIIGPRDIVRIIEEIGFHASPAQRNSGAHHLDHKVEIKQWRKSFLCSLVFGIPVMGLMIYMLVPSHEPHEAMVLDRNIIPGLSILNLIFFILCTFVQLLGGWYFYVQAYRSLKHGTANMDVLIVLATTIAYTYSFVILVVAVAEKAERSPVTFFDTPPMLFVFIALGRWLEHVAKSKTSEALARLMSLQATEAIVVTLGEDNLIVREEQVPMELVQRGDVIKVVPGGKFPVDGKILEGNTMVDESLITGEAMPVTKKPGSIVIAGSINAHGSVLVNATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADRFSGYFVPFIIIISTLTLVVWIIIGFIDFGVVQKYFPTHSKHISQAEVIIRFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITHGVPKVMRVLLLVDVAMMPLRKVLAVVGTAEASSEHPLGVAITKYCKEELGTDSLGYCTDFQAVPGCGIGCKVSSVEGLLAHSESQQSKQAAPPSRAGSAPEEIDVTPQTFSVLIGNREWMRRNGLTISSDVSDAMANHELKGQTAVLVAVDGVLCAMIAIADAVKQEAALAVHTLKSMGVDVVLITGDNRKTARAIATQVGINKVFAEVLPSHKVAKVQELQNEGKKVAMVGDGINDSPALAQADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVWRIHLNLVLALIYNLIGIPIAAGVFMPIGIVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDLERYEAQAQGRMKPLTASQVSVYIGMDDRRRDSPRATPWDQVSFISQVSLSSLKSDKLSRHSAAADDGGDKWSLLLNDRDEEQCI"

     misc_feature    610..801
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(628..636,643..645)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    865..1053
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(883..891,898..900)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1207..1383
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1225..1233,1240..1242)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1513..1704
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1531..1539,1546..1548)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1903..2091
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1918..1926,1933..1935)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2128..2319
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(2146..2154,2161..2163)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2383..4491
                     /gene="ATP7B"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(3376..3378,3382..3384,4420..4422)
                     /gene="ATP7B"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(3508..3516,3718..3720,3871..3879,3967..3969,
                     4087..4095,4153..4155,4162..4164,4171..4173,4228..4230,
                     4237..4239)
                     /gene="ATP7B"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      

gtgggagttgggctgggggggcgtggcctgtgatgaactggcagcgcacccgccctccgccccctcccccattgtaagccccctcccagagcccgccggcagttgagaccaatgggaagcccttgcgcatctcggatcgattttccaggtgcggagttcactcccgcggctgctgcagcgtttgggatcagcggagctccggagcaaggcgcggagctgacccgagcccggctcccgccacgccgcaccttccccggcggcgactggcgagccctgggatctgcatctgcggtccggctctgcgctgctcgcccgccctcctgtccttcgcggcacacgccggaggccgaagacccagtccgcagtgcaccggcccgaggtgacctgcgggctctggcccgatcaccgaagaaattggctcccccgaaggaggttgcttgaacaaggaaagacattacacccagagaagaggccagtcggaaaatcttgtctaaactttccttgcccgctcgtgcccgggagccagcgatgaagcagagttttgcctttgacaatgtcggctacgaaggcggcctggacactgtggacccccctcagacggccaccggcaccatcagcatttcgggcatgacttgccagtcatgtgtaaagtctatcgagggcaggatttccagcctgaaaggcatcgtgagcattaaggtttccctggaacagggcagtgcgacggtgaggtatgtgccgtccatcctgagcctgccgcagatttgccgtcacattgaggacatgggctttgaggccagcgttgcagagggaaaggctgcctcctggccttcgaggtcctcgcctggcctcgaggctgtggtcaagcttcgggtggaaggcatgacctgccagtcctgcgtcagctccatcgaaggcaagctcgggaaactgcagggagtagtgagagtccgagtgtccctcagcacccaggaggcagttattacataccagccttacctgattcagccccaggacctcagggaccacgtcagtgacatgggctttgaagctgtcatcaagaacaaagtggcgcccgtaagcctgggacccatcgatatcgggcgcttacagagcaccaatccaaagacccctttggcatctgataaccagtctctcaataactctgagacctcagagcaccaagggagccacacggtcaccctgcaactgagagtagatggaatgcactgtacgtcttgtgtcatgaatattgaagaaaacataggccagctgcccggggttcaaagtgttcaagtgtccttggagagcagactggcccaagtacagtatgacccttctcgcgtcaccgccaccgccctgcagagggccatcgaagcgcttccacctgggaacttcaaagtctctcttcctgatggtgtgacaggaaatgggacaggtcgcaggtcttccaaccgtgttgtccctgcccccacgctgagaccccaggtgcagggggtgtgcgatactgtggtgctcgccattgctggcatgacctgtgcgtcctgtgcccagtccatcgaaggcctcatctcccaaagggaaggggtacagcggatatcggtctctgtggctgacgggactggcgtggttctctatgatccgtctgttactaacccggaagaactccgagctgctgttgaagaaatgggatttgaggcttcagtcatttctgaaaactattccaccaaccatgttggaaaccacagtgcggggacttccccagcgccccccgaagctggcgttcctgtgtttgtacaggaagtggctccccgtgccggggagccccctaaaaaccacaactccggctcctcgtccgagcccccacaggcctctaccacggtggctccccagaagtgctttctacagattggaggcatgacctgtgcatcctgtgtgtcccacatagagaagagcctgcagaaggaagcaggtattctgtcagtgctggttgccctcatggctgggaaggcagaggtcaagtataacccagaagtcatccagcccctggagatagctcagctcatccaggacatgggctttgaggcgacagtaatggaagactacacaggctccgatggcgacctcgaactcatcatcacggggatgacctgtgcgtcctgtgttcacaacattgagtccagactcacaaggacaaacggcatcacttacgcctctgtggcccttgccaccagcaaagcccacgtgaaatttgatcctgaaattatcggtccacgggatattgtccgaattatcgaggaaatcggctttcatgcttccccggcccagagaaactccggcgcgcatcacttggaccacaaggtggaaataaagcagtggaggaagtctttcctgtgcagcctggtgttcggcatccccgtcatgggtctcatgatctacatgctggtgcccagccatgagccccacgaggccatggtcctggaccgcaacatcattccgggactgtccatcctcaatctcatcttctttatcttgtgtacctttgtccagctcctcggtgggtggtacttctacgtccaggcctacaggtctctgaagcatgggacagccaacatggacgtgctcatcgtgctggctaccaccatcgcctacacctactcatttgtcatcctagtggtggccgtagccgagaaggcggagaggagccccgtgaccttcttcgacaccccccccatgctctttgtgttcattgccctggggcggtggctggaacacgtggcaaagagcaaaacctcagaagcccttgccagactcatgtctctccaagccacagaagccatcgttgtcacccttggtgaggacaacttgattgtcagggaggagcaggtgcccatggagctggtgcagcggggcgacgtcatcaaggttgtccccggggggaagttcccagtggatgggaaaatcttggaaggcaacaccatggtggacgagtccctcatcacaggagaagccatgcctgtcacgaagaaacctggaagcatagtgattgctgggtctataaatgcacatggctctgtactcgttaatgccactcacgtgggcaatgacaccacattggctcagatcgtgaaattggtagaagaggctcagatgtcaaaggcacccattcagcaactggctgaccggtttagtgggtattttgtcccatttatcatcatcatttcaacgctgacgttggtggtatggattataatcggttttatcgattttggtgttgttcagaaatactttcctacccacagcaagcacatctcccaggcagaggtgatcatccggtttgcgttccagacgtccatcaccgtgctgtgcatcgcctgcccctgctccctgggcctggccacgcccacagcggtcatggtgggcaccggggtggccgcccagaatggcatcctcatcaaaggaggcaagcctctggagatggcccacaagataaagaccgtgatgtttgacaaaactggcaccatcacccatggggtccccaaagtcatgagggtcctcctgctcgtggatgtggccatgatgcccctcaggaaggttcttgctgtggtggggactgcagaggccagcagcgagcaccccttgggcgtggcaatcaccaagtactgtaaagaggaattgggaaccgactccttgggatactgcacggacttccaagcagtgcccggctgtggaatcggctgcaaagtcagtagtgtggagggcctcctggcccacagcgagagccagcagagcaaacaggcggctcccccgagcagggctggcagcgctcccgaggaaatagacgtgaccccccagaccttctctgtgctcatcgggaaccgcgaatggatgaggcgcaacggcctaaccatttccagcgacgtcagtgacgcgatggcgaatcatgagctgaaaggccagacggccgtgctggtggccgttgacggcgtgctctgtgccatgatcgccatcgccgacgcagtcaagcaggaggcagccctggccgtgcacacgctgaagagtatgggtgtggacgtggttctgatcacaggggacaaccggaagacggccagagccatcgccacccaggttggtatcaacaaagtctttgcagaggtgctaccttctcacaaggtggccaaggtccaggagctccagaatgaagggaagaaagttgccatggtaggagacgggattaatgactcgccggccttggcccaggctgatgtgggcattgccatcgggacaggcacggatgtcgccatcgaggctgctgacgttgtcctcattagaaacgatttgctcgatgtggtggctagcattcacctctccaagaggaccgtctggagaatacacctcaacctggtgctggcgttgatttataacctgatcggaatacccatcgcggcaggggtcttcatgcccatcggcatcgtgctgcagccgtggatgggctcggcggccatggcggcctcctctgtgtctgtggttctctcgtcgctgcagctcaagtgctataagaagcctgacctggagcggtatgaggcccaggcccagggccgcatgaagcccctgacagcgtcgcaggtgagcgtgtacatcggcatggatgaccggcggcgggactccccgagggccacaccctgggaccaggtcagcttcatcagccaggtgtctctgtcctccctgaagtccgacaagctgtctcgacacagtgctgcggctgatgatggtggggacaagtggtctctgctcctgaacgacagagatgaggagcagtgcatctgaaagctgcaggcgggtggagacccaggggtctgtctcctcactgagtagctggtccggcttccccggggaccgaggctcaggccgaacaggcacagctccagcggcaagatgggcgaagctcccctccagccctggggacttccactccctcctggagatggctggtcatccctcctagcatgggcggtgcccctatgtggctcctgggtcacccacctccccgtccccactgggatcccagcggcacaggggccaggcttcccggcctgaccatgctgtgggcctgggcttgtcgggaaccttgctggactctagcagagcagaggacggccagccttcctcacaggcctctgctttagtgtttggaacgactacttgtaaaaagaggaaaatctcatcgggaccaaaaacttagctgggcctttcctcacgagaagcctcgtgttgggttctttttgacaacacccacatgattgcgtatctgagaccacagtttacctcaaatacaccccactgatgtctgccggca

//