2024-04-27 00:19:27, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_032207927 5331 bp mRNA linear VRT 30-JAN-2020 DEFINITION PREDICTED: Aythya fuligula ATPase copper transporting beta (ATP7B), mRNA. ACCESSION XM_032207927 VERSION XM_032207927.1 DBLINK BioProject: PRJNA602521 KEYWORDS RefSeq. SOURCE Aythya fuligula (tufted duck) ORGANISM Aythya fuligula Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Anseriformes; Anatidae; Aythyinae; Aythya. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_045559.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Aythya fuligula Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.3 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..5331 /organism="Aythya fuligula" /mol_type="mRNA" /isolate="bAytFul2" /db_xref="taxon:219594" /chromosome="1" /sex="female" /tissue_type="lung (powdered)" /dev_stage="adult" /country="Sweden" /lat_lon="59.8509 N 17.6300 E" /collection_date="28-Aug-2017" /collected_by="Patrik Ellstrom, Mahmoud Naguib, Josef Jarhult" gene 1..5331 /gene="ATP7B" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 4 Proteins, and 99% coverage of the annotated genomic feature by RNAseq alignments" /db_xref="GeneID:116502163" CDS 14..4600 /gene="ATP7B" /codon_start=1 /product="copper-transporting ATPase 2" /protein_id="XP_032063818.1" /db_xref="GeneID:116502163" /translation="
MERKGESKIRRELSCLATLNNKNITLVSIRKRQAARDVPELLIIGEKPRAGSPVEASSNLQKEEKVLQSNSMGMPEVNTIERQALSDTDSPPSCALEPTMKQHFAFDNMGYEESFETLPSPSSQERTVAVRVVGMTCQSCVQSVEGRISKVKGVVSIKVSLEQNNALVKYLQSEISPEQICQEIHDMGFDANVAEKRLTPASVSLPCSREAVIKLRIEGMTCQSCVTSIEGKMKKLHGVAKIKVSLANQEAIIAYQPYIIQPEELKSHISSLGYDCTIKSKSAPLKLSVLDLGRLQSADPKETPASLESDGLEPQAARMGGTATVAVQIEGMHCKSCVRNIEGNISSLPGVQSINVSLERKCAVVRYSPNLITLSALQRAIESLPPGNFKVRLPNDSEANNQPSPPPALPCGLAGEPLDDTTCTAVIRIDGMTCNSCVQSIEGTISQRQGVQHVAVSLAGKTGTIRYDPAVTNGEDLRAAIEDMGFDASVLTDTGTGEHKHRPGASDAAVQPQALESPHQDRASDPLLQGPHLDGPNQPGEAKKCFLQITGMTCASCVSAIERKLQKEDGIVSVLVALMAGKAEIKYKPEFIQPLEIAQLIQNLGFEATVIEDHAETEGNVELLITGMTCASCVHNIESKLMRTNGIFYASVALATCKAHIQFDPEITGPRDIIKIIEEIGFHASVSRRVPNAHNLDHKKEIQQWRKSFLCSLVFGIPVLILMIYMLIPDGGHHGSMVLEQNLIPGLSILNLLFFVLCTFVQFLGGWYFYLQAYKSLKHKTANMDVLIVLATTIAYVYSCVILMVAIIEKAEKSPVTFFDTPPMLFVFIALGRWLEHIAKSKTSEALAKLISLQATEATVVTLGPDHSIIREEQVAVELVQRGDIVKVVPGGKFPVDGKVIEGSSMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVNATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADRFSGYFVPFIIIISTVTLLVWITIGFIKFDIIQKYFPNQNKDVTKAELILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITCGVPKVMRVLLLGDTAVLSLKKVLAVVGTAEASSEHPLGVAVTKYCKEELGTQSLGYCTNFQAVPGCGISCKVGGVEAVLGMAEEGLGELDANRSGDSSVPLEDNALIALPESEGPSASHVYSVLIGNREWMRRNGLHIANDVNDAMTDHETKGQTAVLVAIDGALCGMIAIADTVKQEAALAVHTLKNMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNERRKVAMVGDGVNDSPALARADIGIAIGTGTDVAIEAADVVLIRNNLLDVVASIHLSKRTVRRIRINLILALIYNLLGIPIAAGVFMPVGLVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDTESYEAQAQGRMKPLTPSQISVHIGMDDRRRDSSRPAPWDQISQVSLSSLTSDKLPRRNGFFEEEGDKWSLLMNGRDEEQYI"
misc_feature 401..586 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(416..424,431..433) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 653..844 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(671..679,686..688) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 992..1165 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1007..1015,1022..1024) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1289..1480 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1307..1315,1322..1324) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1652..1840 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1667..1675,1682..1684) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1877..2068 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1895..1903,1910..1912) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 2132..4273 /gene="ATP7B" /note="P-type heavy metal-transporting ATPase, similar to human copper-transporting ATPases, ATP7A and ATP7B; Region: P-type_ATPase_Cu-like; cd02094" /db_xref="CDD:319783" misc_feature order(3125..3127,3131..3133,4202..4204) /gene="ATP7B" /note="putative Cu binding site [ion binding]; other site" /db_xref="CDD:319783" misc_feature order(3257..3265,3467..3469,3653..3661,3749..3751, 3869..3877,3935..3937,3944..3946,3953..3955,4010..4012, 4019..4021) /gene="ATP7B" /note="putative ATP binding site [chemical binding]; other site" /db_xref="CDD:319783" ORIGIN
gcctgcaaagataatggagaggaaaggggagagtaaaataagaagggaactgtcctgcttagctactttaaacaacaaaaacataaccctggtgtctattcgtaagcggcaggcagctcgtgatgtgcctgaactactgattatcggtgaaaaacccagagcaggatctccggtagaagcaagcagtaacttgcagaaagaagagaaagttttgcaaagtaactccatggggatgccagaagtcaatacaattgaaagacaggctttgtccgacactgattcccctcctagctgtgcactggaacctacaatgaaacagcattttgcttttgacaacatgggctacgaggagagctttgaaaccctgccctcgccatcttcccaggagcgcactgttgcagtcagggttgtggggatgacttgccagtcctgcgtgcagtcagtagaaggacgaatttccaaggtgaagggcgtcgtgagcattaaagtctcccttgaacagaataatgccctagtaaagtacctgcagtcagaaataagcccggaacagatttgccaggaaattcatgacatgggttttgacgctaatgtcgcagaaaagaggttgacaccggcatctgtaagtttaccgtgctcgagggaagcggtaataaagcttcggatagaaggcatgacgtgccagtcctgtgtcaccagcatcgagggaaagatgaagaagctgcatggtgtggcaaaaatcaaggtgtcgctcgctaaccaggaggcaatcattgcttaccagccttacatcattcagcccgaggaactcaagagccatatcagcagcctggggtacgactgcaccattaagagtaaatcagcacctttgaagctcagtgtgcttgatcttgggcgcctgcagagcgcagaccccaaggagacaccggcgagtcttgagagtgatgggttggagccacaggctgccaggatgggtggcacagcgaccgtggctgtgcagatagaaggcatgcactgcaagtcctgtgtcagaaacatcgaaggaaacatatcctctcttccaggcgtgcaaagtattaacgtgtctttggagcgtaaatgtgctgttgtacggtacagcccaaatttaattaccctgtcagctctgcagcgagctattgagtcccttccacctggaaactttaaagtgcgcctccctaatgattcagaagcaaataaccaaccatctccaccgcctgctttgccgtgtggtctcgctggagagccgctggacgacacgacgtgcacggctgttattaggatcgatggtatgacctgcaattcctgtgtgcagtccatagaagggacgatatcgcagagacaaggtgtgcagcacgtagcagtttctttagctggcaagactgggaccatacgttatgatccagctgtcacaaatggagaagacttgagagctgccatagaagacatggggtttgatgcgtctgtgctaacagatactggcacgggagaacacaagcatcggcctggcgccagcgatgctgcggtgcagcctcaagctctggagtctcctcaccaggatcgtgcctcagatcctcttctgcagggtcctcacctcgacgggccaaaccagcccggtgaagccaagaagtgttttttacaaatcactggcatgacctgtgcgtcgtgcgtgtctgccatcgaaaggaaactgcagaaggaagacggaattgtttcagtgttggtagccctgatggcaggtaaagcagagataaaatacaagccagagttcatacagcctcttgaaattgcacagctgatccagaatttgggttttgaggctactgtcatagaagatcatgcagaaacagaaggaaatgtggagcttcttattacagggatgacttgtgcttcgtgtgttcacaacattgaatccaaacttatgagaacaaacggcatattctacgcctcagttgcactggctacttgcaaagctcacatccagtttgatcctgaaattacaggacctcgagacattataaaaataattgaggaaattggctttcatgcttctgtgtctagaagagttccaaatgcacataacttggatcataaaaaagaaatacagcagtggaggaagtctttcttgtgcagcctagtgtttggtatccctgtcttaatcctaatgatttatatgctaatacctgacggcggacaccatgggtctatggtgctggaacagaatctcattcctggattatctatattaaatcttctcttctttgtcctgtgcacttttgttcagtttcttggtggatggtatttttacctacaagcttacaaatccctgaagcacaagacagccaatatggatgtgctcatcgtactggccacgacgattgcttatgtgtattcctgtgtgatcctgatggtggccatcattgaaaaggcagagaaaagtcctgtcactttctttgacactcctccaatgctgtttgtattcattgcccttgggagatggctcgaacacatagcaaagagtaagacctcagaagctcttgctaaacttatatctcttcaagccacggaagccactgtggtgactcttggacctgaccactctatcatcagggaggagcaagtagctgttgaactggttcagaggggtgatattgtaaaagttgttcctggtggaaagttccctgtggatggaaaggtgattgaaggcagttctatggcggatgagtctctcattactggggaagccatgccagtcaccaaaaagcctgggagcacggtgatcgctgggtctataaatgcgcatggctcagttcttgttaacgcaacccatgttggtaacgataccaccctagcacagatcgtgaaattggtggaagaagctcagatgtcaaaggcacctatccagcaactggcagataggtttagtggatattttgttccatttatcatcattatttctacagtgaccttgttagtatggatcacaattggttttataaagtttgatatcattcagaaatattttcctaatcagaacaaagacgttacaaaagctgaactgatactgcggtttgcatttcaaacctcaatcaccgtgctgagcattgcatgcccctgttctttaggcttggctaccccaacagctgtgatggtgggcacaggagttgctgcgcagaacggtattctcatcaaagggggaaagcccctggaaatggcacacaagatcaagaccgtgatgtttgataaaactgggaccatcacctgtggagttcctaaagtgatgagggtgcttctgctgggagacacagctgtgctctctctgaagaaggtcctggcagtggttggcactgcagaagccagcagcgagcatcctttaggagtagcagtgactaaatactgcaaagaggagcttggcacccagagcctgggctactgcaccaacttccaggcggtcccaggctgtggcatcagctgtaaagttggcggcgttgaggctgtcctgggcatggccgaggaggggctgggtgagctggatgctaacaggagcggggacagcagcgttcctctggaagataacgcactgatcgcgctccctgaatcagaaggtccgtcagcttcccacgtgtactcggtgctgattggaaatcgcgagtggatgcggcgaaatggcttgcacatcgcaaatgatgtaaatgatgcaatgacagaccacgaaaccaaaggacagactgccgtattagtggctatagatggtgccctgtgtggaatgattgccatagcagacactgtcaagcaggaggcagcccttgctgtgcacacgctgaaaaacatgggaatagacgtggtgctgataacaggagacaacagaaaaactgcaaaagccattgctactcaggttgggatcaaaaaagtcttcgctgaggttcttccttctcacaaggttgcaaaagtccaggagctccaaaacgagaggcggaaggttgcaatggttggtgacggagtcaatgattcccctgcactagccagggctgacattggaattgcgattggaacgggcaccgacgttgccattgaagcagcagacgttgttctcatccgaaacaacttgctagatgttgttgccagtattcacttatcaaagagaacagtacgaaggatacggataaatctgattcttgccttaatctataatctgcttggaataccaatagcagcaggtgtgttcatgcccgtcggcctcgtgcttcagccttggatgggatcagctgcgatggcagcctcctctgtgtccgtcgtgctgtcctccctgcagctgaaatgttataagaagccagacacagaaagttacgaggcacaagctcaaggccgcatgaagccactgactccttcccaaatcagtgttcacatcgggatggatgataggaggagggattcatccagacccgctccctgggatcagatcagtcaagtctctctctcttctttgacttcagacaagctgcccagacgtaatggcttttttgaggaggaaggggacaagtggtcgctgctcatgaacggcagagatgaagagcagtacatctgaagcaccgtgttcttagtgctgcaggaaacatcccagtgacgagaggagctgagttatgccatcaagatcttcaaggttataagcgaagttgttccttcagctcacaaaacgactgcaactcagtctggtgttgagttgtatgggttgtggattccttcaggccaccagttacgtccagtcactgaaagaatctggggctctgtagtgaactggctcctttgcacacagcaaatactgaaataatgtaaaatttcagagtttaatggagtttctctcttctggactgcttgctgggcaccaaatttcatacttttcactgtttttaactttattctttcaagagtacgtgaagcaaaaatatttttcagagcttccaagtactaatttctctgtccaagtgaaaatatccgtggcataaagagctctgtggttggaagctgtatttttaagcagaatcctaactagtcacactactgtgagagcactttatacttaggattcgtgtgcatcttattggaccaaaaatgcttcagtgtttcactgactgcgtttacagatattcctgtttgggacaaactccttaaagtcactaggaatattccgttcttaatgcaattcctggtccaagttagtgcagcagtttcctgtggataccttgcagaatcctttgacatcctggacaattggacagtcggcttgttcttccctcggactgggtgaagaatttttca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]