2024-03-29 19:11:29, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_032099691 4974 bp mRNA linear VRT 23-JAN-2020 DEFINITION PREDICTED: Corvus moneduloides ATPase copper transporting beta (ATP7B), transcript variant X5, mRNA. ACCESSION XM_032099691 VERSION XM_032099691.1 DBLINK BioProject: PRJNA599199 KEYWORDS RefSeq. SOURCE Corvus moneduloides (New Caledonian crow) ORGANISM Corvus moneduloides Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Passeriformes; Corvoidea; Corvidae; Corvus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_045477.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Corvus moneduloides Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.3 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..4974 /organism="Corvus moneduloides" /mol_type="mRNA" /isolate="bCorMon1" /db_xref="taxon:1196302" /chromosome="2" /sex="female" /tissue_type="blood" /country="New Caledonia: near Bourail" /lat_lon="21.599296 S 165.398128 E" /collection_date="17-Oct-2018" /collected_by="Matthew Steele" gene 1..4974 /gene="ATP7B" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 2 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:116439737" CDS 277..4275 /gene="ATP7B" /codon_start=1 /product="copper-transporting ATPase 2 isoform X5" /protein_id="XP_031955582.1" /db_xref="GeneID:116439737" /translation="
MERKLDNKMKRELSYLATLNDRNISLVSIRKQQAARDVPELLIIGEKSKTASLVKTSSNLQKEEELPQSYSMGMTEVNTVERQALSNTDSPPDCELKPTMKHNFAFDNMGYEESSETMPSPPSQEHSVVVNIVGMTCQSCVQSIEGQISKVKGILRIKVSLEQNHAVIKYLQSEISPEQICQEILDMGFDANIAEDKLTTATVNLPSLKEAVVKLRVEGMTCQSCVTSIEGKIRKLHGVAKIKVSLDNQEAIVAYHPYIIQPDDLKRHISDLGYDCTIKSKSAPLKLGALDLQRLQNANPRETPASLKSDGLDPLVTEVGSTATVTLQIEGMHCKSCIRNIEGNISDLPGIKSIKVSLEHKCAVVQYTPDFITLSALQQAIESLPPGNFKVTLHNGSEAGKAASPSGAFTYDLIRQPPQGTTLTAVIKIDGMTCNSCVQSIEGAISQRQGVQHVAVSLAGSTGTIHYDPAVTSGEELRAAIEDMGFDASVLTVYCAFIQDTATGEHRCQPDASKAAVKPGAPEPPHQGCASDALPDSPHLDGSNRLSGATEEKCVLQITGMTCASCVSTIERNLQKEDGIVSVLVALMAGKAEIKYKPELIQPLEIAQLIQNLGFEATVMEDNAETEGQVELLITGMTCASCVHNIESKLMRTNGIFSASVALATSKAHIQFDPEIIGPRDIIKVIKEIGFHASVAKRAPNAHNLDHKKEIQQWRKSFLYSLVFGIPVVVIMIYMQIPNGGDRGSKVLERNLIPGLSILNLLFFILCTFVQFLGGWYFYVQAYKSLRHKTTNMDVLIVLATTIAYLYSCVILIVAIIEKAEKSPVTFFDTPPMLFVFIALGRWLEHIAKGKTSEALAKLMSLQATEATVVTLGPDHSIVREEQVPVELVQRGDVIKVVPGGKFPVDGKVIEGSSMADESLITGEPMPVIKKPGSTVIAGSINAHGSLLVNATHVGSDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLIAWTTIGFVNFDIIKKYFPNQSKNISKAEIILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHQIKTVMFDKTGTITCGVPKVMRVLLMGDTAMLPLKKVLAVVGTAEASSEHPLGMAVTKYCKEELGTESLGYCTDFQAVPGCGISCKVGGVEAILGSELNVNISGDSSAPLGDNAVITLLESQGPSASQKYSVLIGNREWMRRNGLNIRNDVNDAMTNHEMKGQTAILVAIDGMLCGMIAIADTVKQEAALAVHTLQSMGIDVVLITGDNRKTAKAIATQVLHHTADSASTVVCTFFCAVRSVLLLHVIL"
misc_feature 661..849 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(679..687,694..696) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 916..1107 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(934..942,949..951) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1252..1428 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1270..1278,1285..1287) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1552..1743 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1570..1578,1585..1587) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1939..2130 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1957..1965,1972..1974) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 2167..2358 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(2185..2193,2200..2202) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 2422..>4185 /gene="ATP7B" /note="Haloacid Dehalogenase-like Hydrolases; Region: HAD_like; cl21460" /db_xref="CDD:451251" misc_feature 3547..3561 /gene="ATP7B" /note="HAD signature motif I; other site" /db_xref="CDD:319763" ORIGIN
gaacgcagtttggaaagcacgagggatgccaattggtgggaaacatttaaactggcagggagagcaggtagctgagtgcagcaagcagcctacataaggatcacaggttccatctgggattttgtgatgaatgcctaatgagcacatggattagacggacagaactcttcaagcttctgtaaatgtagctgaaagaagcgtggcttacaggacaccaaataactgttcctgtaaaacttttgtttggtgttgcagtatttaaagtccagaaaaataatggagagaaaactggacaataaaatgaaaagggaactgtcctacttagctactttaaacgacagaaacatatccctggtgtctattcgtaagcagcaggcagctcgtgatgtgcctgaactactgattattggtgaaaagtccaagacagcatcgctggtaaaaacaagcagtaacttgcagaaagaagaggaacttccgcagagttactccatgggaatgacagaagtcaatacagttgaaagacaggctttgtccaacactgattctcctcctgattgtgagctgaagcctacaatgaaacataattttgcttttgacaacatgggctatgaggagagctctgaaaccatgccctctccaccttcccaagagcatagtgtggtagtcaacattgtgggaatgacttgccaatcatgtgtgcagtcgatagaaggccaaatttccaaggtgaagggcattttgagaattaaagtctcccttgaacagaaccatgctgttatcaagtatctgcagtcggaaataagtcctgaacagatttgccaggaaattctggatatgggctttgatgccaacatagcagaagataagttgacaacagcgactgtaaatttgccaagcttgaaagaagcagtagttaagcttcgggtagaaggcatgacatgccagtcctgtgtcaccagcattgaaggaaagattaggaaactacacggtgtagcaaaaatcaaggtgtcacttgataaccaagaagcaattgttgcttaccatccttacatcattcagcctgatgacctcaagagacacatcagtgacctggggtatgactgcaccattaaaagcaaatcagcccctttgaagctgggtgcccttgatctccagcgcttgcagaatgcaaaccctagggagacacctgcaagtctcaagagtgatgggctggatccactggttaccgaggtgggtagcacagctacagtgactttacagatagaaggcatgcactgcaagtcctgtatcagaaacatcgaaggaaatatatcagatcttcctggcataaaaagtattaaagtgtctttggagcataaatgtgctgtggtacagtataccccagatttcatcaccctgtcagctttgcagcaagctattgaatcccttccacctggaaactttaaagtaaccctccataatggttcagaagcaggcaaagcagcatctccctcaggtgctttcacatacgatctcatcagacagccaccgcaaggcacgacacttacggctgttattaagattgatggcatgacctgcaattcttgtgtacagtccatagaaggggccatatcacagagacaaggagtgcagcatgtagcagtttctctagctggcagtactgggaccatacactatgatccagctgtcacgagtggagaagagttaagagctgccatagaagacatgggatttgatgcctctgtactgacagtgtattgtgcatttattcaagatactgctactggagaacacaggtgccagcctgatgccagcaaagctgccgtgaaacctggagctccagagcctcctcaccaaggctgtgcctcagatgctcttccagacagtcctcaccttgatgggtcaaacaggctcagtggagccacagaagaaaagtgtgttttacaaatcacaggcatgacctgtgcatcgtgtgtgtctaccattgaaagaaatttgcagaaagaagatggaattgtttcagtgttggtagcactgatggcaggtaaagcagagataaaatacaagccagaactcatacagcctcttgaaatagcacagctgatccagaatctgggttttgaagctactgtcatggaagataatgcagaaacagaagggcaggtggagcttcttattacagggatgacttgtgcttcttgtgttcacaatattgaatccaaactcatgagaacaaatggcatattctctgcctcagttgcacttgcgactagcaaagctcacatccagtttgatcctgaaattattggccctcgagatattataaaagtaatcaaggaaattggctttcatgcttctgtggctaaaagagctccaaatgcacataacctggatcacaaaaaggaaatacagcagtggaggaaatctttcttgtacagcctagtgtttggtattcctgttgtagtcataatgatttatatgcaaatacccaatggtggggaccgtgggtctaaggtgctggaacggaatctcattcctggattatctattttgaatcttctcttctttatcctctgcacttttgttcagttccttggtggatggtatttttacgtacaagcttacaagtcactgaggcacaagacgaccaatatggatgtgctcattgtactggccacgacgattgcttatctgtattcctgtgtgatcctgatagtagcaatcattgaaaaggcagagaaaagcccagtcactttcttcgacactcctccgatgttgtttgtgttcattgcacttggcagatggctggaacacatagccaagggtaagacctcagaagctcttgctaaacttatgtctcttcaagccacagaagccactgtggtgactcttggacctgaccactccattgtcagggaggagcaagtacctgttgaacttgttcaaaggggtgatgttataaaagttgttcctggtggaaagttcccagtggatggaaaggtcattgaaggcagttctatggcagatgagtctctcattactggggaacctatgccagtcattaaaaagcctgggagcacagtgattgctggttctataaatgcacatggctcacttcttgttaatgcaactcatgttggtagtgataccactctggcacagattgtgaaattggtggaagaagctcaaatgtcaaaggcacccatccagcaactggcagataaatttagtggatactttgttccatttatcatcatcatctcaactgtgacattgatagcatggaccacaattggttttgtaaattttgatattattaaaaaatattttcctaatcagagcaaaaacatttcaaaagctgaaataatactgaggtttgcatttcaaacctcgatcactgtgctgagcattgcatgcccttgctctttaggcctggctacccccacagctgtaatggtgggcacaggagtggctgcacagaatggtattctcatcaagggtggaaaacccctggaaatggcacatcagatcaagactgtgatgtttgataaaactgggaccatcacctgtggagttcctaaagtcatgagggtgcttttgatgggagacacagccatgctccccctgaagaaggtactggcagttgttggtacagcagaagccagcagcgagcatcctttaggaatggctgtcactaaatactgcaaagaggagcttggcactgagagcctgggatactgcactgacttccaggcagtcccaggctgtggtatcagctgcaaggtcggaggagttgaggccattcttggcagtgagctgaatgttaacatcagtggggatagcagtgctcctctgggagataacgcagtgatcacgctcttggaatcacaaggtccatcagcttctcagaaatactcggtgttgattggaaatcgtgagtggatgcgacgcaatggcttgaatattagaaatgatgtaaatgatgcaatgacaaaccatgaaatgaaaggacagactgccatactagtggctatagatggtatgttgtgtggaatgatcgcaatagcagacactgtcaagcaggaggcggcccttgctgtgcacacactgcaaagcatgggaatagacgtggtgctgataacaggagacaacaggaaaactgcaaaagccattgctactcaggtattgcaccacacagctgactcagccagcactgtggtatgcacattcttctgcgctgtgaggtctgttttgcttctccatgtgattctttaatcctcctcctgttgtgtttcacacttttcctttagtgttcagttatggtaaagtgctttcccacccaattttctttgtcaagggaaaaaagtctttcagaaacaagcttgaatttgtggttccagaaactaagatgaatgttttaaacaagcgtagtctgtgtcgacctacattttcattgaatttttggagcatacttactttccaatggaaggaaatggacagcagttctaaaaacgttataaaatgttactttttaaagggttaaaagagagcttctgtcttacatggtgaaaagctgcttctgcctggtaaggcagccgaacaaagggcattatcccagcactgtttaatacactcatctatttttaaactacaacactagatctgttggtagcaactccacattagttgagatgtggataagttgaagcatttagccagccgtctgctttatttttataatctccctgagacttgcacatacttgttgtctctgtgtttcccctgctgtaactgcttgatcatacagggttcctgtgttgcattatctgcttgaagtctctgcaaagtgatctggataggctggattgatcagctgaggccagttgtgtgaggttcaaaaaggcaaagtgccaggtcctgcacttgtgtcacaacaactccctgcagcactacaggctgggggcagagtggctg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]