GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-03-29 19:11:29, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_032099691            4974 bp    mRNA    linear   VRT 23-JAN-2020
DEFINITION  PREDICTED: Corvus moneduloides ATPase copper transporting beta
            (ATP7B), transcript variant X5, mRNA.
ACCESSION   XM_032099691
VERSION     XM_032099691.1
DBLINK      BioProject: PRJNA599199
KEYWORDS    RefSeq.
SOURCE      Corvus moneduloides (New Caledonian crow)
  ORGANISM  Corvus moneduloides
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Passeriformes; Corvoidea;
            Corvidae; Corvus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_045477.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Corvus moneduloides Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4974
                     /organism="Corvus moneduloides"
                     /mol_type="mRNA"
                     /isolate="bCorMon1"
                     /db_xref="taxon:1196302"
                     /chromosome="2"
                     /sex="female"
                     /tissue_type="blood"
                     /country="New Caledonia: near Bourail"
                     /lat_lon="21.599296 S 165.398128 E"
                     /collection_date="17-Oct-2018"
                     /collected_by="Matthew Steele"
     gene            1..4974
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 1 sample with support for all annotated introns"
                     /db_xref="GeneID:116439737"
     CDS             277..4275
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X5"
                     /protein_id="XP_031955582.1"
                     /db_xref="GeneID:116439737"
                     /translation="
MERKLDNKMKRELSYLATLNDRNISLVSIRKQQAARDVPELLIIGEKSKTASLVKTSSNLQKEEELPQSYSMGMTEVNTVERQALSNTDSPPDCELKPTMKHNFAFDNMGYEESSETMPSPPSQEHSVVVNIVGMTCQSCVQSIEGQISKVKGILRIKVSLEQNHAVIKYLQSEISPEQICQEILDMGFDANIAEDKLTTATVNLPSLKEAVVKLRVEGMTCQSCVTSIEGKIRKLHGVAKIKVSLDNQEAIVAYHPYIIQPDDLKRHISDLGYDCTIKSKSAPLKLGALDLQRLQNANPRETPASLKSDGLDPLVTEVGSTATVTLQIEGMHCKSCIRNIEGNISDLPGIKSIKVSLEHKCAVVQYTPDFITLSALQQAIESLPPGNFKVTLHNGSEAGKAASPSGAFTYDLIRQPPQGTTLTAVIKIDGMTCNSCVQSIEGAISQRQGVQHVAVSLAGSTGTIHYDPAVTSGEELRAAIEDMGFDASVLTVYCAFIQDTATGEHRCQPDASKAAVKPGAPEPPHQGCASDALPDSPHLDGSNRLSGATEEKCVLQITGMTCASCVSTIERNLQKEDGIVSVLVALMAGKAEIKYKPELIQPLEIAQLIQNLGFEATVMEDNAETEGQVELLITGMTCASCVHNIESKLMRTNGIFSASVALATSKAHIQFDPEIIGPRDIIKVIKEIGFHASVAKRAPNAHNLDHKKEIQQWRKSFLYSLVFGIPVVVIMIYMQIPNGGDRGSKVLERNLIPGLSILNLLFFILCTFVQFLGGWYFYVQAYKSLRHKTTNMDVLIVLATTIAYLYSCVILIVAIIEKAEKSPVTFFDTPPMLFVFIALGRWLEHIAKGKTSEALAKLMSLQATEATVVTLGPDHSIVREEQVPVELVQRGDVIKVVPGGKFPVDGKVIEGSSMADESLITGEPMPVIKKPGSTVIAGSINAHGSLLVNATHVGSDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLIAWTTIGFVNFDIIKKYFPNQSKNISKAEIILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHQIKTVMFDKTGTITCGVPKVMRVLLMGDTAMLPLKKVLAVVGTAEASSEHPLGMAVTKYCKEELGTESLGYCTDFQAVPGCGISCKVGGVEAILGSELNVNISGDSSAPLGDNAVITLLESQGPSASQKYSVLIGNREWMRRNGLNIRNDVNDAMTNHEMKGQTAILVAIDGMLCGMIAIADTVKQEAALAVHTLQSMGIDVVLITGDNRKTAKAIATQVLHHTADSASTVVCTFFCAVRSVLLLHVIL"
     misc_feature    661..849
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(679..687,694..696)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    916..1107
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(934..942,949..951)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1252..1428
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1270..1278,1285..1287)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1552..1743
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1570..1578,1585..1587)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1939..2130
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1957..1965,1972..1974)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2167..2358
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(2185..2193,2200..2202)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2422..>4185
                     /gene="ATP7B"
                     /note="Haloacid Dehalogenase-like Hydrolases; Region:
                     HAD_like; cl21460"
                     /db_xref="CDD:451251"
     misc_feature    3547..3561
                     /gene="ATP7B"
                     /note="HAD signature motif I; other site"
                     /db_xref="CDD:319763"
ORIGIN      
gaacgcagtttggaaagcacgagggatgccaattggtgggaaacatttaaactggcagggagagcaggtagctgagtgcagcaagcagcctacataaggatcacaggttccatctgggattttgtgatgaatgcctaatgagcacatggattagacggacagaactcttcaagcttctgtaaatgtagctgaaagaagcgtggcttacaggacaccaaataactgttcctgtaaaacttttgtttggtgttgcagtatttaaagtccagaaaaataatggagagaaaactggacaataaaatgaaaagggaactgtcctacttagctactttaaacgacagaaacatatccctggtgtctattcgtaagcagcaggcagctcgtgatgtgcctgaactactgattattggtgaaaagtccaagacagcatcgctggtaaaaacaagcagtaacttgcagaaagaagaggaacttccgcagagttactccatgggaatgacagaagtcaatacagttgaaagacaggctttgtccaacactgattctcctcctgattgtgagctgaagcctacaatgaaacataattttgcttttgacaacatgggctatgaggagagctctgaaaccatgccctctccaccttcccaagagcatagtgtggtagtcaacattgtgggaatgacttgccaatcatgtgtgcagtcgatagaaggccaaatttccaaggtgaagggcattttgagaattaaagtctcccttgaacagaaccatgctgttatcaagtatctgcagtcggaaataagtcctgaacagatttgccaggaaattctggatatgggctttgatgccaacatagcagaagataagttgacaacagcgactgtaaatttgccaagcttgaaagaagcagtagttaagcttcgggtagaaggcatgacatgccagtcctgtgtcaccagcattgaaggaaagattaggaaactacacggtgtagcaaaaatcaaggtgtcacttgataaccaagaagcaattgttgcttaccatccttacatcattcagcctgatgacctcaagagacacatcagtgacctggggtatgactgcaccattaaaagcaaatcagcccctttgaagctgggtgcccttgatctccagcgcttgcagaatgcaaaccctagggagacacctgcaagtctcaagagtgatgggctggatccactggttaccgaggtgggtagcacagctacagtgactttacagatagaaggcatgcactgcaagtcctgtatcagaaacatcgaaggaaatatatcagatcttcctggcataaaaagtattaaagtgtctttggagcataaatgtgctgtggtacagtataccccagatttcatcaccctgtcagctttgcagcaagctattgaatcccttccacctggaaactttaaagtaaccctccataatggttcagaagcaggcaaagcagcatctccctcaggtgctttcacatacgatctcatcagacagccaccgcaaggcacgacacttacggctgttattaagattgatggcatgacctgcaattcttgtgtacagtccatagaaggggccatatcacagagacaaggagtgcagcatgtagcagtttctctagctggcagtactgggaccatacactatgatccagctgtcacgagtggagaagagttaagagctgccatagaagacatgggatttgatgcctctgtactgacagtgtattgtgcatttattcaagatactgctactggagaacacaggtgccagcctgatgccagcaaagctgccgtgaaacctggagctccagagcctcctcaccaaggctgtgcctcagatgctcttccagacagtcctcaccttgatgggtcaaacaggctcagtggagccacagaagaaaagtgtgttttacaaatcacaggcatgacctgtgcatcgtgtgtgtctaccattgaaagaaatttgcagaaagaagatggaattgtttcagtgttggtagcactgatggcaggtaaagcagagataaaatacaagccagaactcatacagcctcttgaaatagcacagctgatccagaatctgggttttgaagctactgtcatggaagataatgcagaaacagaagggcaggtggagcttcttattacagggatgacttgtgcttcttgtgttcacaatattgaatccaaactcatgagaacaaatggcatattctctgcctcagttgcacttgcgactagcaaagctcacatccagtttgatcctgaaattattggccctcgagatattataaaagtaatcaaggaaattggctttcatgcttctgtggctaaaagagctccaaatgcacataacctggatcacaaaaaggaaatacagcagtggaggaaatctttcttgtacagcctagtgtttggtattcctgttgtagtcataatgatttatatgcaaatacccaatggtggggaccgtgggtctaaggtgctggaacggaatctcattcctggattatctattttgaatcttctcttctttatcctctgcacttttgttcagttccttggtggatggtatttttacgtacaagcttacaagtcactgaggcacaagacgaccaatatggatgtgctcattgtactggccacgacgattgcttatctgtattcctgtgtgatcctgatagtagcaatcattgaaaaggcagagaaaagcccagtcactttcttcgacactcctccgatgttgtttgtgttcattgcacttggcagatggctggaacacatagccaagggtaagacctcagaagctcttgctaaacttatgtctcttcaagccacagaagccactgtggtgactcttggacctgaccactccattgtcagggaggagcaagtacctgttgaacttgttcaaaggggtgatgttataaaagttgttcctggtggaaagttcccagtggatggaaaggtcattgaaggcagttctatggcagatgagtctctcattactggggaacctatgccagtcattaaaaagcctgggagcacagtgattgctggttctataaatgcacatggctcacttcttgttaatgcaactcatgttggtagtgataccactctggcacagattgtgaaattggtggaagaagctcaaatgtcaaaggcacccatccagcaactggcagataaatttagtggatactttgttccatttatcatcatcatctcaactgtgacattgatagcatggaccacaattggttttgtaaattttgatattattaaaaaatattttcctaatcagagcaaaaacatttcaaaagctgaaataatactgaggtttgcatttcaaacctcgatcactgtgctgagcattgcatgcccttgctctttaggcctggctacccccacagctgtaatggtgggcacaggagtggctgcacagaatggtattctcatcaagggtggaaaacccctggaaatggcacatcagatcaagactgtgatgtttgataaaactgggaccatcacctgtggagttcctaaagtcatgagggtgcttttgatgggagacacagccatgctccccctgaagaaggtactggcagttgttggtacagcagaagccagcagcgagcatcctttaggaatggctgtcactaaatactgcaaagaggagcttggcactgagagcctgggatactgcactgacttccaggcagtcccaggctgtggtatcagctgcaaggtcggaggagttgaggccattcttggcagtgagctgaatgttaacatcagtggggatagcagtgctcctctgggagataacgcagtgatcacgctcttggaatcacaaggtccatcagcttctcagaaatactcggtgttgattggaaatcgtgagtggatgcgacgcaatggcttgaatattagaaatgatgtaaatgatgcaatgacaaaccatgaaatgaaaggacagactgccatactagtggctatagatggtatgttgtgtggaatgatcgcaatagcagacactgtcaagcaggaggcggcccttgctgtgcacacactgcaaagcatgggaatagacgtggtgctgataacaggagacaacaggaaaactgcaaaagccattgctactcaggtattgcaccacacagctgactcagccagcactgtggtatgcacattcttctgcgctgtgaggtctgttttgcttctccatgtgattctttaatcctcctcctgttgtgtttcacacttttcctttagtgttcagttatggtaaagtgctttcccacccaattttctttgtcaagggaaaaaagtctttcagaaacaagcttgaatttgtggttccagaaactaagatgaatgttttaaacaagcgtagtctgtgtcgacctacattttcattgaatttttggagcatacttactttccaatggaaggaaatggacagcagttctaaaaacgttataaaatgttactttttaaagggttaaaagagagcttctgtcttacatggtgaaaagctgcttctgcctggtaaggcagccgaacaaagggcattatcccagcactgtttaatacactcatctatttttaaactacaacactagatctgttggtagcaactccacattagttgagatgtggataagttgaagcatttagccagccgtctgctttatttttataatctccctgagacttgcacatacttgttgtctctgtgtttcccctgctgtaactgcttgatcatacagggttcctgtgttgcattatctgcttgaagtctctgcaaagtgatctggataggctggattgatcagctgaggccagttgtgtgaggttcaaaaaggcaaagtgccaggtcctgcacttgtgtcacaacaactccctgcagcactacaggctgggggcagagtggctg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]