GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-12-06 05:44:45, GGRNA.v2 : RefSeq release 208 (Sep, 2021)

LOCUS       XM_032085862            3474 bp    mRNA    linear   PLN 08-MAR-2021
DEFINITION  Aspergillus pseudonomiae NRDE-2, necessary for RNA
            interference-domain-containing protein (BDV37DRAFT_277778), partial
            mRNA.
ACCESSION   XM_032085862
VERSION     XM_032085862.1
DBLINK      BioProject: PRJNA602443
            BioSample: SAMN05446751
KEYWORDS    RefSeq.
SOURCE      Aspergillus pseudonomiae
  ORGANISM  Aspergillus pseudonomiae
            Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
            Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspergillaceae;
            Aspergillus.
REFERENCE   1  (bases 1 to 3474)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (05-MAR-2021) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   2  (bases 1 to 3474)
  AUTHORS   Mondo,S., Kjaerbolling,I., Vesth,T., Frisvad,J.C., Nybo,J.L.,
            Theobald,S., Kildgaard,S., Isbrandt,T., Kuo,A., Sato,A.,
            Lyhne,E.K., Kogle,M.E., Wiebenga,A., Kun,R.S., Lubbers,R.J.,
            Makela,M.R., Barry,K., Chovatia,M., Clum,A., Daum,C., Haridas,S.,
            He,G., LaButti,K., Lipzen,A., Riley,R., Salamov,A., Simmons,B.A.,
            Magnuson,J.K., Henrissat,B., Mortensen,U.H., Larsen,T.O.,
            Devries,R.P., Grigoriev,I.V., Machida,M., Baker,S.E.,
            Andersen,M.R., Cantor,M.N. and Hua,S.X.
  CONSRTM   DOE Joint Genome Institute
  TITLE     Direct Submission
  JOURNAL   Submitted (16-APR-2019) DOE Joint Genome Institute, 2800 Mitchell
            Drive, Walnut Creek, CA 94598-1698, USA
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_022475994).
            
            ##Metadata-START##
            Organism Display Name :: Aspergillus pseudonomius CBS 119388
            GOLD Stamp ID         :: Gp0108191
            ##Metadata-END##
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..3474
                     /organism="Aspergillus pseudonomiae"
                     /mol_type="mRNA"
                     /strain="CBS 119388"
                     /culture_collection="CBS:119388"
                     /type_material="culture from type material of Aspergillus
                     pseudonomiae"
                     /db_xref="taxon:1506151"
                     /chromosome="Unknown"
     gene            <1..>3474
                     /locus_tag="BDV37DRAFT_277778"
                     /db_xref="GeneID:43670553"
     CDS             1..3474
                     /locus_tag="BDV37DRAFT_277778"
                     /codon_start=1
                     /product="NRDE-2, necessary for RNA
                     interference-domain-containing protein"
                     /protein_id="XP_031946745.1"
                     /db_xref="GeneID:43670553"
                     /db_xref="InterPro:IPR013633"
                     /db_xref="JGIDB:Asppsen1_277778"
                     /translation="
MDSSSSQPEKKSIPRFASFKPRPAPPPEADRPPERRSRDSSDKEDRHRHHSKRHRSRHRHHRDRSRSRDRRRERKNIRHDHKEASHSERELIPEHRLVLQDTVKLEAEASDLYVVDRKGDRYNIIYGTIHRYNVPLYYRIGRGSVLGLPPTNKIDRDTAEGDALIIKADAWRSDSSRTRSKSIISGGNTQRTKLLRIRPAPTLDAAADASKDYLPLTASVHHKRSDVSGHEGSDDERYGYRSIHGKAKQEDNLPSDMEEVSDTDLSGDETARVDPDKEVKQRNVELSRNVERNPTDVRAWIDLVEHQESLLKGSEGETKTLTYAEKKSLADIKISLYEKALKKVGGHASRDLLLLGLLEEGAKLWDTKKLSARWQAVLKSNPHFISLWVKYLDFRQTEFLEFTYERCYATFIDCMRLNRSASDNPEKAHVQVYLFLRLTLFIREAGFTEHAVGLWQAILELTFFQSGTTDSVTAREEVLSAFMDFWDSEVVRIGEVGAKGWQSGLNTLLEPRSFTSQNRVNSKSVFASWMSCERERINNARLPARSLDEENDDPYRVVLSADLLEVLSLVWGLASTDVLVDSFLYFCHLPPIAFSSNSKTTNHWMGDSFLRNEFMSSSDSTLDRWVPKYDTDTRNTASAPGYFQNFVHSFDTLFADHEAWFSSIGPWATSVLNSRSDVDPGWVSKVLRSLVELMPQNDHLAAYAIAVEFAGDRSKAAKYAKSLLKKRPSSLWLYNVYALIERRSGNLEAANRVWETTLSMSQNSKTFTEEEKVDAVFLWHTCIWEMLEAGSLDYVSYLFSSMPQSSPSLKAPVDPKQYIFNPTSLLKTQSLLSDNQEASLAAGKANTFVACTDCLAILTYLSNSRDLNKALQPYSNGFNRLATLPAKFESFRSISIELLHQARARLLYYHARTSSIYKPSQIRALLADSISLFPHNTIFLSLFAWNESRFRIEERVRDTIMDITTKAHNRADQIFTTQVPITSHLFSIFTELNRPVYAGSTPHSVRAAFEKAIGDKDPMTSTHHNTLSTARSNLTLWKLYILFEISQHDINRAKDVFYRGMRACPWSKELIMLAFSHLRADIVRELHPSASRKGDGMNFFELRSVYNVLIEKELRVHVDIEDELDELLAEMQQKTAALGLPIAMPEDADSEDEQMQL"
     misc_feature    343..651
                     /locus_tag="BDV37DRAFT_277778"
                     /note="MTR4-interacting domain (MID) found in nuclear
                     exosome regulator NRDE2 and similar proteins; Region:
                     NRDE2_MID; cd22200"
                     /db_xref="CDD:412062"
     misc_feature    order(343..360,367..372,382..387,391..393,397..426,
                     430..444,451..456,499..501,505..513,532..540,565..570,
                     574..588,625..651)
                     /locus_tag="BDV37DRAFT_277778"
                     /note="MTR4 binding site [polypeptide binding]; other
                     site"
                     /db_xref="CDD:412062"
     misc_feature    853..1764
                     /locus_tag="BDV37DRAFT_277778"
                     /note="necessary for RNA interference; Region: NRDE-2;
                     pfam08424"
                     /db_xref="CDD:400637"
ORIGIN      
atggattcctctagctctcagccggagaagaagtccatccctcggttcgccagcttcaagcctcgaccagcgcctccacccgaagctgatcggcctcccgagcgccgcagtcgcgacagctccgacaaagaagacaggcacagacaccactcaaaacgacaccgttcgagacacaggcatcaccgagaccgttcccgctctagagatcgtcgaagagagcgtaaaaacatccgtcatgaccataaggaggcgtctcattccgaacgggagcttattcctgagcaccgattggtgctgcaagacaccgtgaagttagaggcggaggcgtcagatctatatgttgtggatcgtaaaggtgatagatacaatatcatatacggtactattcatcgttacaatgttccgctctactaccggataggtcgaggtagcgtgctaggtcttcctccaaccaataagatcgatcgcgataccgccgaaggagacgcgttgatcatcaaggcagacgcctggcgctccgatagctcaaggacaaggtcgaagagtataatatctggggggaacacacagagaacgaaactacttcggatacgaccagcacctacgttagatgcagctgcagacgcctcgaaagattatcttccacttacggcctccgtgcatcacaaacgcagcgatgtctcaggacatgagggttcggacgacgagagatatggctatcgttcaattcatggaaaggcgaagcaagaggataaccttcccagtgacatggaagaagtatcagacaccgatttgagtggtgacgagacggcgcgagtcgaccctgataaagaagttaaacagcgcaatgtcgagctgtccaggaatgttgagcgcaatcccaccgatgtgcgtgcatggattgaccttgtcgagcatcaggaatctcttctgaaaggctccgaaggagaaacgaaaaccctcacgtatgctgaaaagaagagcttggccgatatcaagatatccctctatgagaaagccttgaagaaggttggaggacatgcttctcgtgatcttcttctcctcggtcttctagaagaaggcgccaaactttgggacacgaaaaagctttcagcacggtggcaggctgtactgaaatcaaatcctcatttcattagcctctgggtcaaatatcttgatttccgacagactgaatttcttgaatttacttacgaacgatgctatgctacgttcattgactgtatgagattgaacagatctgcatccgacaacccggagaaagcccatgttcaagtctacctcttccttcgcttgacgcttttcattcgggaagctggattcaccgaacatgcagtaggtctatggcaagcaattctagagctgacgttctttcaatcggggacaacggattctgtcacagctcgagaagaggtgctgtcggcgttcatggatttctgggattctgaagttgtgcgtattggtgaagttggtgcaaagggctggcagagcggccttaatactcttttggagcccagatccttcacatcacaaaatcgagtgaactcgaagtctgtattcgcgtcttggatgtcatgcgaacgggaacgaattaacaacgctcgccttccagctcgcagcttagatgaagagaacgatgatccctatcgtgtagttctctcggccgatctgctggaggtcctatcgcttgtatggggcttagcatcaacagacgtgctggttgacagctttctatatttctgtcatcttcctcctattgcattctccagcaactcgaagacaaccaatcactggatgggtgacagcttcttgcgaaatgaattcatgagcagctctgattccacgcttgatcgctgggttcctaaatacgacaccgatactagaaataccgcttcggcgccgggctacttccagaactttgttcattcattcgatactcttttcgcggaccacgaagcatggttctcctccattggtccttgggctacaagcgtactgaactctcggtccgatgtcgaccccggttgggtttccaaggtattgagatctttggtagagctgatgccacaaaatgaccatttggctgcgtatgcgattgcggtggagtttgcaggtgaccgcagcaaggcagcaaagtatgcaaaatccttactcaaaaagcggccgtccagcctgtggctctacaatgtgtatgctcttattgaacgtcggtcaggcaacctggaggccgccaaccgtgtgtgggagaccactctatctatgagccaaaacagtaagacgtttactgaggaggaaaaggtcgatgctgttttcctttggcatacttgtatatgggagatgctggaggctggcagcttagattatgtatcttatctcttcagttctatgcctcagagcagtcctagcctgaaggctccggtggatcctaaacaatacatattcaacccaacaagcctgctgaagactcagagtttactatcagataaccaagaggcctcgcttgcagccggaaaagccaacacttttgtggcctgcacggactgtctagcaatactaacctacctttctaactctcgggatctaaataaagcccttcagccatacagcaatggcttcaacagacttgcaacattgccagcaaagttcgaatcgttcagatccatttctattgaactcctgcaccaagcgcgtgcaagactgctctactatcacgcccgcacaagcagcatatacaagccctcccagattcgtgctctgctggcagatagcatatccttattcccccataacacgatatttctgtccctctttgcttggaatgaatctcggttccgtatcgaagagcgcgtcagggataccatcatggacataacgacgaaagcccacaaccgtgccgaccaaatcttcacaacccaagtaccaatcacatcccacttattctccatcttcaccgaactaaatcgtcctgtgtatgccggttctaccccacactctgtccgtgcggctttcgaaaaggctattggcgacaaagacccgatgacctcaacccaccataacacactttccaccgcccgctccaacctcacactctggaaactctacattctcttcgagatatctcagcacgacatcaatcgtgccaaagatgtcttctaccgtggcatgcgcgcctgtccatggtccaaagagctcatcatgcttgccttcagccatctcagggcagatatcgtccgggagctgcatccaagcgcatcacggaagggcgatggcatgaacttctttgagctacgaagtgtgtataatgtcctgatagagaaggaattgcgggttcatgtcgatatcgaagatgagttggacgagctgttggcggagatgcagcagaagacagctgcgctggggctaccaattgccatgccggaagatgccgatagcgaggatgagcagatgcaactatga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]