GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-19 13:20:09, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_032073474             432 bp    mRNA    linear   PLN 26-MAY-2020
DEFINITION  Aspergillus caelatus uncharacterized protein (BDV27DRAFT_162951),
            partial mRNA.
ACCESSION   XM_032073474
VERSION     XM_032073474.1
DBLINK      BioProject: PRJNA602440
            BioSample: SAMN05445973
KEYWORDS    RefSeq.
SOURCE      Aspergillus caelatus
  ORGANISM  Aspergillus caelatus
            Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
            Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspergillaceae;
            Aspergillus.
REFERENCE   1  (bases 1 to 432)
  AUTHORS   Kjaerbolling,I., Vesth,T., Frisvad,J.C., Nybo,J.L., Theobald,S.,
            Kildgaard,S., Isbrandt,T., Kuo,A., Sato,A., Lyhne,E.K., Kogle,M.E.,
            Wiebenga,A., Kun,R.S., Lubbers,R.J., Makela,M.R., Barry,K.,
            Chovatia,M., Clum,A., Daum,C., Haridas,S., He,G., LaButti,K.,
            Lipzen,A., Mondo,S., Riley,R., Salamov,A., Simmons,B.A.,
            Magnuson,J.K., Henrissat,B., Mortensen,U.H., Larsen,T.O.,
            Devries,R.P., Grigoriev,I.V., Machida,M., Baker,S.E. and
            Andersen,M.R.
  CONSRTM   DOE Joint Genome Institute
  TITLE     Friends and foes A comparative genomics studyof 23 Aspergillus
            species from section Flavi
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 432)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (22-MAY-2020) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 432)
  AUTHORS   Mondo,S., Kjaerbolling,I., Vesth,T., Frisvad,J.C., Nybo,J.L.,
            Theobald,S., Kildgaard,S., Isbrandt,T., Kuo,A., Sato,A.,
            Lyhne,E.K., Kogle,M.E., Wiebenga,A., Kun,R.S., Lubbers,R.J.,
            Makela,M.R., Barry,K., Chovatia,M., Clum,A., Daum,C., Haridas,S.,
            He,G., LaButti,K., Lipzen,A., Riley,R., Salamov,A., Simmons,B.A.,
            Magnuson,J.K., Henrissat,B., Mortensen,U.H., Larsen,T.O.,
            Devries,R.P., Grigoriev,I.V., Machida,M., Baker,S.E.,
            Andersen,M.R., Cantor,M.N. and Hua,S.X.
  CONSRTM   DOE Joint Genome Institute
  TITLE     Direct Submission
  JOURNAL   Submitted (16-APR-2019) DOE Joint Genome Institute, 2800 Mitchell
            Drive, Walnut Creek, CA 94598-1698, USA
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_022475547).
            
            ##Metadata-START##
            Organism Display Name :: Aspergillus caelatus CBS 763.97
            GOLD Stamp ID         :: Gp0108191
            ##Metadata-END##
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..432
                     /organism="Aspergillus caelatus"
                     /mol_type="mRNA"
                     /strain="CBS 763.97"
                     /culture_collection="CBS:763.97"
                     /type_material="type material of Aspergillus caelatus"
                     /db_xref="taxon:61420"
                     /chromosome="Unknown"
     gene            <1..>432
                     /locus_tag="BDV27DRAFT_162951"
                     /db_xref="GeneID:43657920"
     CDS             1..432
                     /locus_tag="BDV27DRAFT_162951"
                     /codon_start=1
                     /product="uncharacterized protein"
                     /protein_id="XP_031922193.1"
                     /db_xref="GeneID:43657920"
                     /db_xref="JGIDB:Aspcae1_162951"
                     /translation="
MEKLPGLNLERAFSEFQLAKRNRVRIVFAKAIREFYSFKLSHHDPARRNIIWDEGTERCFIVDLEDVDELDHPVFSPPRFDPWSDFRVWELCSGELDPDEANYDQMVPGPQEEIEDTDEALYALAARTKHISKCSDNLAAKLN"
ORIGIN      
atggagaaactccctggattgaaccttgaacgagcattctctgaatttcaacttgcgaaaagaaatcgagtgcggatagtctttgctaaagctattcgcgagttctacagcttcaagctttcccaccatgaccctgctcgacgtaatattatctgggatgaaggaaccgagcgatgcttcatagtcgatcttgaagacgttgatgagttggaccatccagtcttcagccctccccgttttgatccgtggagtgattttagagtatgggagctctgctcaggagaattggatccagatgaagctaattatgatcaaatggtgcctgggccacaagaagagattgaggatactgatgaggcgctgtatgctctagcggctcgtacgaaacatatatcaaagtgtagtgacaatttagcggccaagttaaattga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]