LOCUS       XM_031923907             920 bp    mRNA    linear   INV 29-FEB-2020
DEFINITION  PREDICTED: Nasonia vitripennis uncharacterized LOC116416229
            (LOC116416229), partial mRNA.
ACCESSION   XM_031923907
VERSION     XM_031923907.1
DBLINK      BioProject: PRJNA594415
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Nasonia vitripennis (jewel wasp)
  ORGANISM  Nasonia vitripennis
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Endopterygota; Hymenoptera; Apocrita;
            Proctotrupomorpha; Chalcidoidea; Pteromalidae; Pteromalinae;
            Nasonia.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_022279607.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Nasonia vitripennis Annotation
                                           Release 104
            Annotation Version          :: 104
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 100% of CDS bases
            ##RefSeq-Attributes-END##
            COMPLETENESS: incomplete on the 5' end.
FEATURES             Location/Qualifiers
     source          1..920
                     /organism="Nasonia vitripennis"
                     /mol_type="mRNA"
                     /strain="AsymCx"
                     /db_xref="taxon:7425"
                     /chromosome="2"
                     /map="unlocalized"
                     /sex="male"
                     /tissue_type="whole animal"
                     /dev_stage="adult"
                     /genotype="PSR+"
     gene            <1..920
                     /gene="LOC116416229"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 Protein"
                     /db_xref="GeneID:116416229"
     CDS             <1..920
                     /gene="LOC116416229"
                     /codon_start=3
                     /product="uncharacterized protein LOC116416229"
                     /protein_id="XP_031779767.1"
                     /db_xref="GeneID:116416229"
                     /translation="

RDLELDRDFDLDRELDLDRDFDLDLDFELDRDLDLDFDFDIERDFDLDFDLDLERDLDVDFDSDLDFDFDLVFDLDLERDFDFDLVFDLDLERDLDLDFDENLERSKDTPPTILEIDLERDLDLDRDLDLERELHLDRDLELDRDFVLDRDFDLDRELDLDRDFDLDLDFDLDRDFELDRDLDLDFDFDIERDFDLDFDLDLERDLDVDFDSDLDFDFDLVFDLDLERDFDFDLVFDLDLERDLDLDFDENLERSKDTPPTILEIDLERDLDLERDLDLERDLVLDCNFDPDGDCDLDCDFEKCP"

ORIGIN      

accgtgacttagagctagaccgtgattttgaccttgaccgtgaattagacctagaccgtgactttgacctagacctcgactttgagctagaccgtgacttagaccttgactttgacttcgatatagaacgtgactttgaccttgactttgacttagatctagaacgtgacttagacgttgactttgactcagatcttgactttgactttgaccttgtctttgacttagacctagaacgtgactttgactttgaccttgtctttgacttagacctagaacgtgacttagaccttgattttgacgaaaatcttgagaggtcgaaagacacaccaccaacgatacttgaaattgaccttgaacgtgacttagatctagatcgtgacttagacctagagcgtgaattacacctggaccgtgacttagagctagaccgtgattttgtcctagaccgtgattttgaccttgaccgtgaattagacctagaccgtgactttgacctagacctcgactttgacctagaccgtgactttgagctagaccgtgacttagaccttgactttgacttcgatatagaacgtgactttgaccttgactttgacttagatctagaacgtgacttagacgttgactttgactcagatcttgactttgactttgaccttgtctttgacttagacctagaacgtgactttgactttgaccttgtctttgacttagacctagaacgtgacttagaccttgattttgacgaaaatcttgagaggtcgaaagacacaccaccaacgatacttgaaattgaccttgaacgtgacttagatctagaacgtgacttagacctagagcgtgacttagtgttagattgtaacttcgatccagacggcgactgtgatcttgattgtgactttgaaaagtgcccgtaa

//