GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-25 16:18:43, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_031920711             549 bp    mRNA    linear   INV 23-DEC-2019
DEFINITION  PREDICTED: Apis florea probable inactive protein kinase
            DDB_G0270444 (LOC105737407), mRNA.
ACCESSION   XM_031920711
VERSION     XM_031920711.1
DBLINK      BioProject: PRJNA86991
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Apis florea (little honeybee)
  ORGANISM  Apis florea
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Endopterygota; Hymenoptera; Apocrita;
            Aculeata; Apoidea; Anthophila; Apidae; Apis.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_003789699.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Apis florea Annotation Release 102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 100% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..549
                     /organism="Apis florea"
                     /mol_type="mRNA"
                     /db_xref="taxon:7463"
                     /chromosome="Unknown"
                     /sex="male"
                     /note="haploid drones"
     gene            1..549
                     /gene="LOC105737407"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 Protein"
                     /db_xref="GeneID:105737407"
     CDS             1..549
                     /gene="LOC105737407"
                     /codon_start=1
                     /product="probable inactive protein kinase DDB_G0270444"
                     /protein_id="XP_031776571.1"
                     /db_xref="GeneID:105737407"
                     /translation="
MCYTQAEKTKFATMTAEMLKLEKEKIVEDEGEDEDVIEDELEEMVEDEVDDEVEDEVEDEVEDEVEDEVDDEVVDEVKVEDEVENEAKDVEDEVEGEVEEEVEIKVEDEVEYELKIEDKVEDKTEDEVEVQDNVEFGDDVEDEDEVENELVIKNDDEVEDEVDVEDEDEIEDELEDDDKVEV"
ORIGIN      
atgtgttacactcaagctgagaagacaaaatttgcaactatgacagcagaaatgttgaaattagaaaaagaaaaaatagtagaagatgaaggagaagatgaagatgtaatagaagatgaactagaagaaatggtagaagatgaagtggacgatgaagttgaagatgaagtggaagatgaagttgaagatgaagtggaagatgaagtggatgatgaagtggtagatgaagtaaaagtagaagatgaagtagaaaatgaagcgaaagatgtggaagatgaagtggaaggtgaagtagaagaagaagttgaaataaaagtagaagatgaagtagaatatgaactaaaaatagaagataaagtagaagataaaacagaagatgaagtagaagtacaagataatgtagaatttggagatgatgtagaagatgaagatgaagtggaaaatgaattagtaataaaaaatgatgatgaagtagaagatgaagtagatgtagaagatgaagatgaaatagaagatgaactagaagatgatgataaagtagaagtataa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]