2024-04-25 16:18:43, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_031920711 549 bp mRNA linear INV 23-DEC-2019 DEFINITION PREDICTED: Apis florea probable inactive protein kinase DDB_G0270444 (LOC105737407), mRNA. ACCESSION XM_031920711 VERSION XM_031920711.1 DBLINK BioProject: PRJNA86991 KEYWORDS RefSeq; includes ab initio. SOURCE Apis florea (little honeybee) ORGANISM Apis florea Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta; Pterygota; Neoptera; Endopterygota; Hymenoptera; Apocrita; Aculeata; Apoidea; Anthophila; Apidae; Apis. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_003789699.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Apis florea Annotation Release 102 Annotation Version :: 102 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.3 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## ##RefSeq-Attributes-START## ab initio :: 100% of CDS bases ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..549 /organism="Apis florea" /mol_type="mRNA" /db_xref="taxon:7463" /chromosome="Unknown" /sex="male" /note="haploid drones" gene 1..549 /gene="LOC105737407" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 Protein" /db_xref="GeneID:105737407" CDS 1..549 /gene="LOC105737407" /codon_start=1 /product="probable inactive protein kinase DDB_G0270444" /protein_id="XP_031776571.1" /db_xref="GeneID:105737407" /translation="
MCYTQAEKTKFATMTAEMLKLEKEKIVEDEGEDEDVIEDELEEMVEDEVDDEVEDEVEDEVEDEVEDEVDDEVVDEVKVEDEVENEAKDVEDEVEGEVEEEVEIKVEDEVEYELKIEDKVEDKTEDEVEVQDNVEFGDDVEDEDEVENELVIKNDDEVEDEVDVEDEDEIEDELEDDDKVEV"
ORIGIN
atgtgttacactcaagctgagaagacaaaatttgcaactatgacagcagaaatgttgaaattagaaaaagaaaaaatagtagaagatgaaggagaagatgaagatgtaatagaagatgaactagaagaaatggtagaagatgaagtggacgatgaagttgaagatgaagtggaagatgaagttgaagatgaagtggaagatgaagtggatgatgaagtggtagatgaagtaaaagtagaagatgaagtagaaaatgaagcgaaagatgtggaagatgaagtggaaggtgaagtagaagaagaagttgaaataaaagtagaagatgaagtagaatatgaactaaaaatagaagataaagtagaagataaaacagaagatgaagtagaagtacaagataatgtagaatttggagatgatgtagaagatgaagatgaagtggaaaatgaattagtaataaaaaatgatgatgaagtagaagatgaagtagatgtagaagatgaagatgaaatagaagatgaactagaagatgatgataaagtagaagtataa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]