GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-24 14:45:55, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_031903275            2804 bp    mRNA    linear   VRT 18-DEC-2019
DEFINITION  PREDICTED: Xenopus tropicalis testis and ovary specific PAZ domain
            containing 1 (topaz1), transcript variant X2, mRNA.
ACCESSION   XM_031903275
VERSION     XM_031903275.1
DBLINK      BioProject: PRJNA205740
KEYWORDS    RefSeq.
SOURCE      Xenopus tropicalis (tropical clawed frog)
  ORGANISM  Xenopus tropicalis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Amphibia; Batrachia; Anura; Pipoidea; Pipidae; Xenopodinae;
            Xenopus; Silurana.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_030682.2) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Xenopus tropicalis Annotation
                                           Release 104
            Annotation Version          :: 104
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2804
                     /organism="Xenopus tropicalis"
                     /mol_type="mRNA"
                     /strain="Nigerian"
                     /db_xref="taxon:8364"
                     /chromosome="6"
                     /sex="female"
                     /tissue_type="liver and blood"
                     /dev_stage="adult"
                     /note="F17 inbred"
     gene            1..2804
                     /gene="topaz1"
                     /gene_synonym="c3orf77"
                     /note="testis and ovary specific PAZ domain containing 1;
                     Derived by automated computational analysis using gene
                     prediction method: Gnomon. Supporting evidence includes
                     similarity to: 1 mRNA, 10 ESTs, 1 Protein, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 13 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:100380130"
                     /db_xref="Xenbase:XB-GENE-5887135"
     CDS             152..2641
                     /gene="topaz1"
                     /gene_synonym="c3orf77"
                     /codon_start=1
                     /product="protein TOPAZ1 isoform X1"
                     /protein_id="XP_031759135.1"
                     /db_xref="GeneID:100380130"
                     /db_xref="Xenbase:XB-GENE-5887135"
                     /translation="
MFYTQLLFHCYRSSTHDVVPDDPELFGTPEDPYISPICNADNKENNKRNNLSALMCNLQEQESAHINESTNDASPEENVEERSTYFAKVITDLEVNDDPLIIHNTLEKNSEDFYDGGQFDFEAFRDLDTDKEIKYAEKNSSESGSSFEESLSKDTSPGSSHSNSRRWRRDPSHTYKPMHWMNDFRYSGKCMGLTDVITLDQKEQRNIDNLFYDFTPIQKTFLPIRYCKYFFNTFRGCIKPDCMYQHVPFQRDEKVCMEVIHKLVNENHTTLLKRAVWIFTAYYRMYMPGVHYDSNLLTKMLRALYVRQMWGDVFQLLETGANVKILPSSEMLIRLFENIGSTGLTAAVPSLVDVFCKLVEAGMMMKPEQINMLITTLNNLQATKNYISVILDIKTRIEMQLSEKNWLCNLDIAVAEVGHCKEKNDWKKLGTLYLNLRTGCENVTDLKKFSNCIVGALQKVPRNDKSEIPYCDFADTVYKDAQLSEIDKNILGRIGISIMYHYYRNKQSQKGKRVLRKLQEMQINFTVLKGLTGEESKATRCQVVNTAVEIFLNCEYLNGALGVLRESEWIINTQVWPCERMDVLKRHNLLCTIAQKTLNKNMFDVCLEVLQNLPGLQCSLTDVDVSQYSLLFNKLLSSCIENNTLGVSSTVIDFMIAKKIPLDFFLLRALITSLGRSCLWLRARELYKCAVLLGCYPPMEGNLYRKVLFIPSFLSEIEMLLSIEIFMVSNASSIQSPGGSHQTLQIILKRCEEERVPNKDYQRGKASYQDAVDRLIQASRLSTPRLFIKHLTVNNANEQVYILDYGSSLKWLHENMKWAGKVWLFQGKI"
     misc_feature    1400..1927
                     /gene="topaz1"
                     /gene_synonym="c3orf77"
                     /note="Putative aspartate racemase; Region:
                     Asp_Glu_race_2; pfam14669"
                     /db_xref="CDD:434113"
ORIGIN      
cgtcattaacgtgagagaagcgtagtatgccgcgcaggcggagctgaatttgcgacttccggaagcgcgccgaatgacagcagaaatgctgtggattcccttgtgtttcagagcataagaggaaaaaggagagtgcacagcagaaaactttatgttctacacacaactgttatttcactgttacagatccagcacacacgatgttgttccagatgatccagagctttttgggactcctgaagatccttacataagtccaatttgtaatgctgacaacaaagaaaataataaacggaataatctgagtgcattaatgtgtaaccttcaggaacaggagagcgcccatatcaatgaaagcacaaatgatgccagccctgaggaaaatgtagaagagagaagtacatattttgcaaaagtaatcactgatctagaagttaatgatgatcctctcatcatacataacactttggaaaagaacagtgaagatttttatgatggtggacagtttgattttgaggcgttcagagatcttgacacagataaagagattaaatatgctgaaaagaattcatctgaaagcggaagcagttttgaagagtccttgtccaaggatacttctccggggtcctctcattccaatagccgtcgttggagaagagatccctcacatacctataagcctatgcattggatgaatgatttcagatactctggaaaatgcatgggattgacggatgtgattactttggatcagaaagaacagaggaatattgataatctcttttacgattttacacctatacagaagacctttttgcccattagatactgcaaatatttttttaatactttccgtggatgcattaaaccagattgtatgtaccagcacgtaccattccaaagggatgaaaaggtgtgcatggaggtgattcacaaacttgtgaatgaaaatcacacaacattattaaaacgtgctgtttggatatttactgcctactacagaatgtatatgcctggtgttcattatgactcaaatctgctgaccaaaatgctccgtgccttgtatgttcgtcagatgtggggagatgtatttcagttgttggaaactggtgccaatgtcaaaatattgccctcctctgaaatgcttatcaggttatttgaaaatattggctctacgggattaacagcagctgtacctagtttagtggatgtattctgcaagcttgtggaggctggaatgatgatgaagccagagcaaatcaacatgttaataacaacactgaataatctccaggcaacaaaaaattatatcagtgtcattttagacataaaaacaagaattgaaatgcagctttcagaaaagaactggctgtgtaacttggatatagcagttgcagaagttgggcattgtaaagaaaaaaatgattggaagaaactaggaacattatatcttaatctgcgtacagggtgtgagaatgtgactgatcttaagaagttttctaattgcattgtcggggcgcttcagaaagtgccaaggaatgataaatctgaaattccatattgtgactttgcagacacagtgtacaaagacgcccaactaagtgaaattgacaaaaacattttgggaaggattggaatatccatcatgtatcactattacagaaataaacaatcgcaaaagggaaagagggtgctcagaaaacttcaggaaatgcagattaatttcacagtcctaaaaggactcacaggggaagagagtaaagctacgcgctgtcaagttgtgaacacagctgtagagatcttcttgaactgtgaatacttaaatggtgcactgggggttctacgagagtcagagtggatcattaacacacaagtgtggccctgtgaaagaatggatgtgctgaaacgacataacctgttgtgtacaattgcacagaaaacactgaataaaaacatgtttgatgtgtgtcttgaggtccttcagaatctgccaggactgcagtgctcattaacggatgtggatgtctctcagtacagcttgcttttcaacaaacttttgtcatcctgcatagaaaataatacacttggtgtatcctcaactgtgatagattttatgattgcaaaaaaaataccacttgactttttcttactgagagcactaatcacatccttgggacgaagctgtctatggctcagagcaagagaactttataaatgcgctgttttgttgggttgctacccgcccatggaaggaaatctgtatcgtaaagtgctcttcatcccctcattcctttctgagatagaaatgctgttatccattgaaattttcatggtgtcaaatgccagtagtattcagtcaccaggaggcagccatcagactctgcaaatcattctcaaaagatgtgaagaagagagagttccgaataaagattatcaaagaggtaaagctagctatcaagatgcagtggaccggctgattcaggcctctaggctatcaacaccaagattattcataaagcacctgactgtcaataatgccaatgaacaggtttatatccttgattacggcagctctctcaaatggttgcatgaaaacatgaaatgggctgggaaagtatggctttttcaggggaaaatataacttgatatcaggaggtttaactaagcaagtaatgaaaattttaaattaaagtgtctgtttaatttgttttattaatgtgtattttccacttttattgtccttatctgttgacaaaatggtttaagactgtacacaaaataaaatatatagtataaggaaaaca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]