2024-04-29 22:48:44, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_031791527 2160 bp mRNA linear VRT 09-DEC-2019 DEFINITION PREDICTED: Oncorhynchus kisutch butyrophilin subfamily 3 member A2-like (LOC109886139), transcript variant X8, mRNA. ACCESSION XM_031791527 VERSION XM_031791527.1 DBLINK BioProject: PRJNA378663 KEYWORDS RefSeq. SOURCE Oncorhynchus kisutch (coho salmon) ORGANISM Oncorhynchus kisutch Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Protacanthopterygii; Salmoniformes; Salmonidae; Salmoninae; Oncorhynchus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_034189.2) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Oncorhynchus kisutch Annotation Release 101 Annotation Version :: 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.3 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2160 /organism="Oncorhynchus kisutch" /mol_type="mRNA" /isolate="150728-3" /db_xref="taxon:8019" /sex="female" /tissue_type="muscle" /dev_stage="juvenile" /country="Canada: Vancouver" /linkage_group="LG16" /note="double haploid" gene 1..2160 /gene="LOC109886139" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 long SRA read, 1 Protein, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 3 samples with support for all annotated introns" /db_xref="GeneID:109886139" CDS 208..2025 /gene="LOC109886139" /codon_start=1 /product="butyrophilin subfamily 3 member A2-like isoform X8" /protein_id="XP_031647387.1" /db_xref="GeneID:109886139" /translation="
MKTFPTSAVWCFGILFISASLITTGSSEVQVVGPADRVDALAGDDIILPCSLKPNISAKDMLVQWTGLYLKTRNVHLYRQGRDSNEDQFPSYRGRTSMFHEELKNGNVSLKLTRVTLSDAGSYRCFLPTLTSQVKETTVQLFVGAVSQPVISIVGTKDWGVVLKCESGGWFPEPEMEWLDSSGTILPADGPPERHRDSEDLYALRRHVTVDQTDTNRFTCRVHQTEINHLKETEIHVPDDVFPKSHVGLIIGLSILLAVVVLAASAGVYKWRKHTDKVTRERDGLKGELMELREENNKLKIETDNVKMEREELREENNKLKIETDNVKMEREKFRKDNDKLKIETDNVKMEREELREENNKLKIETDKLKIETDNVKMEREKFRKDNDKLKIETDNVKMEREKFRKDNDKLKIETDNVKMEREKFRKDNDKLKIETDNVKMEREKFRKDNDNVKMEREKFRKDNDKLKIETDNVKMEREELREENNKLKIETDNVKMEREELREENNKLKIETDNVKMEREELREENNKLKIETDNVKMEREELREENKKLKKDKGKLKRPSNPIQSPPLQEVNRKQTPSQKSEGIEGMKLESFPAPEMETLPEG"
misc_feature 295..636 /gene="LOC109886139" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 343..357 /gene="LOC109886139" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 391..411 /gene="LOC109886139" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 529..543 /gene="LOC109886139" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 571..588 /gene="LOC109886139" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 613..624 /gene="LOC109886139" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 670..915 /gene="LOC109886139" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 688..702 /gene="LOC109886139" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 730..741 /gene="LOC109886139" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 823..837 /gene="LOC109886139" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 856..873 /gene="LOC109886139" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature <1045..1851 /gene="LOC109886139" /note="Chromosome segregation ATPase [Cell cycle control, cell division, chromosome partitioning]; Region: Smc; COG1196" /db_xref="CDD:224117" ORIGIN
agaagtactgtaagtgaaagtgaaagtaaagtgtgaaactccaccacccttttcctccgttatttctggaacagacgtcgtgttacattctgtgcgttgccaaattagcctttcaactgttttggtttatgtttctaaactcctaataattttattcaccagttacaaacagctttaccttggagtcagacttgttttgttagtgaaatgaagacctttccgacctcggcggtctggtgttttgggattctgttcatcagtgcttcattgataacgacagggtcgtctgaggttcaggttgttggaccggctgaccgagttgatgccttagctggtgatgacatcattctaccatgttccctgaaacccaatattagtgctaaggacatgctagtgcagtggacaggattgtacctgaaaacaagaaacgtccatctttatcgtcaaggtcgagactccaatgaggatcagtttccatcctacaggggaaggacatcaatgtttcatgaagaactgaagaacggcaacgtctccttaaagctgaccagagttactctctctgatgctggaagctacaggtgcttccttccaacactgaccagccaggtgaaggaaaccactgttcaactctttgttggtgctgtatctcagccagtgatctctattgttggaactaaagactggggggtggtcctgaagtgtgagtctggaggctggtttcctgaacctgagatggagtggctggacagttctggaaccatcctccctgctgatggacctccagagagacacagggactcagaggacctctacgctctgagacgacatgtcactgtggaccagactgacaccaacaggttcacctgtagagttcaccagacggagatcaatcacctgaaggagacagagattcatgtcccagatgacgtgtttcctaaatcacacgtagggttgattattggtctgtcaatactattagctgttgtagttctcgcagcttcagctggtgtctacaagtggagaaaacatacagacaaggtcacaagagagagggatggactcaaaggagagctgatggagctcagagaagagaacaacaagctcaaaatagagactgacaacgtcaaaatggagagggaggagctcagagaagagaacaacaagctcaaaatagagactgacaacgtcaaaatggagagggagaagttcagaaaagacaacgacaagctcaaaatagagactgacaacgtcaaaatggagagggaggagctcagagaagagaacaacaagctcaaaatagagactgacaagctcaaaatagagactgacaacgtcaaaatggagagggagaagttcagaaaagacaacgacaagctcaaaatagagactgacaacgtcaaaatggagagggagaagttcagaaaagacaacgacaagctcaaaatagagactgacaacgtcaaaatggagagggagaagttcagaaaagacaacgacaagctcaaaatagagactgacaacgtcaaaatggagagggagaagttcagaaaagacaacgacaacgtcaaaatggagagggagaagttcagaaaagacaacgacaagctcaaaatagagactgacaacgtcaaaatggagagggaggagctcagagaagagaacaacaagctcaaaatagagactgacaacgtcaaaatggagagggaggagctcagagaagagaacaacaagctcaaaatagagactgacaacgtcaaaatggagagggaggagctcagagaagagaacaacaagctcaaaatagagactgacaacgtcaaaatggagagggaggagctcagagaagagaacaagaagctgaaaaaagacaaaggaaagctgaagagaccatccaatccaatccaatctccacctctccaggaggtcaacaggaaacagactccttcccaaaagtctgaggggattgaagggatgaagctggagtcttttcctgctcctgagatggagactttacctgaaggatgatctggagaagttgtgggtggaagttgagtttctatagagctgagttactatagagagactataactatagagctgagttactatagagagactataactatagagagactataactatagagagactataactat
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]