LOCUS       XM_031684582            4289 bp    mRNA    linear   MAM 22-NOV-2019
DEFINITION  PREDICTED: Vicugna pacos ATPase copper transporting beta (ATP7B),
            transcript variant X5, mRNA.
ACCESSION   XM_031684582
VERSION     XM_031684582.1
DBLINK      BioProject: PRJNA221631
KEYWORDS    RefSeq.
SOURCE      Vicugna pacos (alpaca)
  ORGANISM  Vicugna pacos
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Tylopoda;
            Camelidae; Vicugna.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_021964184.1) annotated using gene prediction method: Gnomon,
            supported by mRNA evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Vicugna pacos Annotation Release 102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4289
                     /organism="Vicugna pacos"
                     /mol_type="mRNA"
                     /isolate="Carlotta (AHFN-0088)"
                     /db_xref="taxon:30538"
                     /chromosome="14"
                     /map="unlocalized"
                     /sex="female"
                     /tissue_type="blood"
                     /dev_stage="adult"
     gene            1..4289
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 mRNA, 3 Proteins, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 1 sample with support for all
                     annotated introns"
                     /db_xref="GeneID:102544967"
     CDS             340..4164
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X5"
                     /protein_id="XP_031540442.1"
                     /db_xref="GeneID:102544967"
                     /translation="

MERAGGEKSGSPEPSFLATLADPQVTLLSVHKRWSFRRSPGARGSIRPVTSEEEGCRPEEGGFSQKVLNGTQEIGSDQILSKLPWTARAWEPEMKQSFAFDNTGYEDGLDGMYPSQTATGTISIAGMTCQSCVQSIEGRVSSLKGIVSIKVSLEQGSAAVKYVPSVLSLPQVCSHIEDMGFEASVAEGKAASWPYRSSPVPEAVVKLRVEGMTCQSCVSSIEGKIGKLQGVVRVRVSLGSREAVITYQPYLIQPQELRDHVNDMGFEAIIKNKGAPMSLGLIDVRRLQSAHPKVPLASSNQNGSNSETSGHRGSQVVTLHLGVDGMHCKSCVLNIEDNIGQLPGVQSIHVSLEDRSAQVQYDPSCISPGALQRAIEALPPGKFKVSLPDGAEESGTEARRHSPGPPQGLPEPGAHWTAVLSIAGMTCMSCVQSIEGLVSQREGVQRISVSLAEGTGMVLYDPSVTSAEELRAAVEDMGFEASVLAENCSSNHVGNYSAESSTGQAGPPRSVQEAAPRPGGLPENHNPGRLSESPPASETAAPQKCFLRITGMTCASCVSNIERNLQKEAGILSVLVALMAGKAEVKYNPGVIQPLEIVQLIQDLGFEAAVMEDCAGSDGDLELIITGMTCTSCVHNIESILTRTNGITYASVALATSKAHVKFDPETIGPRDIVRIIGEMGFRASPAQRNPTAHHLDHKVEIKQWKKSFLCSLVFGIPVMGLMIYMLIPSNEPHESMVLDHNIIPGLSILNLIFFILCTFVQFLGGWYFYVQAYKSLRHRAANMDVLIVLATSIAYIYSLVILVVAIAEKAERSPVTFFDTPPMLFVFIALGRWLEHVTKSKTSEALAKLMSLQATEATVVTLGEDSLIIREEQVPMELVQRGDTIKVVPGGKFPVDGKVLEGSTMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVTATHVGNNTTLAQIVKLVEEAQMSKAPIQQLADRFSGYFVPFIIIISTLTSVVWIVIGFTDFGVVQKYFPTPNKHISQVEVVFRFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITHGVPKVMRVLLLVDMATLPLRKVLAVVGTAEASSEHPLGVAVTRYCKEELGTETMGYCTDFQAVPGCGIGCKVSSVEGILAQGERLQSEQTAHLNGVSSVPVETDAAPQTFSVLIGNREWMRRNGLTVTSDVSDAMTDHEMKGQTAILVAIDDCSRPEDSFAPRPGLRSALLALTWGCLLQVCSVG"

     misc_feature    700..891
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(718..726,733..735)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    955..1143
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(973..981,988..990)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1306..1473
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1315..1323,1330..1332)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1594..1785
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1612..1620,1627..1629)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1978..2166
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1993..2001,2008..2010)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2203..2394
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(2221..2229,2236..2238)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2458..>4062
                     /gene="ATP7B"
                     /note="Haloacid Dehalogenase-like Hydrolases; Region:
                     HAD_like; cl21460"
                     /db_xref="CDD:451251"
ORIGIN      

tacgcggtggccgggcgtccaagcagttctgcgtgtgcgaggggctgtgtacagagattcctagggccaaataaatgcagtgtgatgagtaagaggatgccagttggtttgaggggtgtagataaacaagagcaaatatacatacagcagtgtgcagcctgccctggttcctggaagcctggctggcagcctccccgggctggctcaggggcagggcagcaggtgcctccccctcactagttaggaagacgcttttcaagcgttttcttctgacgtgaccaaatagcccgaagacgaactgctgttgcggcaggtggaggtgtcactgtggacttggcgatggagagagctgggggcgagaagtctgggagccctgagccgtccttcctggcgactctggctgacccacaggtgaccctgttgtctgtccacaaacggtggtccttcaggagaagccctggagcgagaggctccatcaggccagtgacttcggaggaggaaggctgtcgtcctgaggagggaggattttcacagaaggttttgaatggaacacaggagatcggttccgatcagatcctgtctaagcttccctggactgctcgagcctgggagccagagatgaagcagagttttgcctttgacaacactggctatgaggatggcctggacggcatgtacccctctcagacggccaccggcacgatcagcatcgcgggcatgacctgccagtcatgtgtgcagtccatcgagggcagggtctccagtttgaagggcatcgtgagcattaaggtttccctggaacagggcagcgcggccgtgaagtacgtgccgtcagtcctgagcctacctcaggtttgcagtcacatcgaggacatgggcttcgaagccagtgtggcggagggaaaggctgcctcctggccgtacaggtcctcgcccgtcccagaggccgtggtcaagcttcgggtggagggcatgacctgccagtcctgcgtcagctccatagaaggaaagatcgggaaactgcaaggtgtcgtgagggtccgcgtctcgctcggcagccgggaggcggtcatcacttaccagccttaccttattcaaccacaagagctcagagaccatgtaaacgacatggggtttgaagccatcatcaagaacaagggggcccccatgagcctgggactgatcgatgtcagacggctgcagagcgcccacccaaaggtgccgctagcttccagcaatcagaatggcagtaactcagagacctcggggcaccgggggagccaggtggtcaccctgcacctgggcgtggatggaatgcactgtaagtcttgcgtcctgaatatcgaagacaacataggccagctcccaggagttcagagcattcacgtgtccttggaggacagatctgcccaagtgcagtacgacccttcttgcatctccccgggggccctgcagagggccatcgaggctcttccacctgggaagtttaaagtttctcttcctgatggagcagaagagagtggaacagaagccagacgccactcccccgggcccccccagggcctcccagagcccggtgcgcactggaccgcggtgctctccatcgccggcatgacctgcatgtcctgcgtccagtccatcgagggcctggtctcccagagggaaggggtgcagcggatatcggtctctttggctgaagggaccggaatggttctctacgatccgtctgtgactagtgcagaagaactccgagctgccgtggaggacatgggatttgaggcatccgtcctggctgaaaactgttccagcaaccatgttgggaactacagtgctgagagttccacggggcaggctggcccccccaggtctgtgcaggaggcagctccccgccctgggggactccctgaaaaccacaaccccggccgcttgtccgagtccccaccggcctccgagacagcggccccgcagaagtgcttcctacgaatcaccggcatgacctgcgcgtcctgtgtgtccaacatagagagaaacctgcagaaggaagctggtattctctccgtgctggttgccctgatggctgggaaggcagaggtgaagtataacccgggagtcatccagcccctggagatagtgcagctcatccaggacctgggcttcgaggcagcagtgatggaggactgcgcgggctcggacggcgacctggagctgatcatcacagggatgacctgcacctcctgtgttcacaacatagagtccatactcacaaggacaaatggcatcacctacgcctctgtggctctcgccaccagcaaagcccacgtgaagtttgatcctgaaacgatcggcccgcgggatattgtcagaattattggggaaatgggctttcgtgcttccccggcccagaggaaccccaccgctcatcacttggaccacaaggtggagataaagcagtggaagaagtctttcctgtgcagcctggtgttcggcatccctgtcatgggtttaatgatctacatgttgatacccagcaatgagccgcacgagtctatggtcctggaccacaacatcatcccaggactgtccattctcaatctcatcttctttatcttgtgtacctttgtccagttcctcggaggctggtacttctacgttcaggcctacaagtctctgagacacagggcggccaacatggatgtgctcatcgtgctggccacgagcatcgcctacatctactccctggtcatcctggtggtggccatcgctgagaaggccgagaggagccccgtgacgttcttcgacactcctcccatgctcttcgtgttcattgccctcggacggtggctggaacacgtgacaaagagcaaaacctcagaagcccttgccaaactcatgtctctgcaagccacagaagccaccgtcgtgactctcggtgaagacagcttaatcatcagggaggagcaggtgcccatggagctggtgcagcgtggcgataccatcaaggtcgtccccgggggcaagttcccggtggacgggaaagtcctggaaggcagcaccatggccgacgagtccctcatcacaggagaggccatgccggtcaccaagaaacctggcagcacggtgatcgccgggtccataaacgcccacggctctgtgctcgttactgccacccacgtgggcaacaacaccaccctggctcagatcgtgaagttggtggaagaggctcagatgtcaaaggcacccattcagcaactggctgaccggtttagtggatattttgtcccatttatcatcatcatttcaactttgacatcggtggtatggattgtaatcggttttaccgattttggtgttgttcagaaatactttcctacccccaacaagcatatctcccaggtggaggtggtcttccggtttgcgttccagacgtccatcacggtgctgtgcatcgcctgcccctgctccctgggcctggccacgcccacggccgtcatggtgggcaccggcgtggccgcccagaacggcatcctcatcaagggaggcaagcccctggagatggcccacaagataaagactgtgatgtttgacaaaactggcaccattacccatggggtccccaaagtcatgcgggtcctcctgctcgtggacatggccacgctgcccctcaggaaggttctcgctgtggtggggaccgcggaggccagcagtgagcaccccttgggcgtggcagtcaccagatactgtaaagaggaacttggaacagagaccatgggatactgcacggacttccaggcggtgccaggctgcggaatcggctgtaaagtcagcagcgtggagggcatcctggcgcagggcgagcgcctgcagagcgaacagaccgctcacctgaatggggtcagcagcgtccccgtggaaacagatgcggccccacagaccttctctgtgctgatcggaaaccgagagtggatgaggcgcaacggcttgacggtcaccagcgacgtcagcgacgccatgaccgatcacgagatgaagggccagacggccatcctggtggccatcgacgactgttcccgtcctgaggactcatttgctcctcggcctgggctgcgcagtgctctgcttgcacttacctgggggtgtctcctgcaggtgtgctctgtgggatgatcgccatcgcggatgccgtcaagcaggaggccgccctggccgtgcacacactgaagagcatgggtgtggacgtggttctgatcacgggggacaaccgcaagacagccagagccatcgccacccag

//