2024-04-25 12:52:20, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_031684582 4289 bp mRNA linear MAM 22-NOV-2019 DEFINITION PREDICTED: Vicugna pacos ATPase copper transporting beta (ATP7B), transcript variant X5, mRNA. ACCESSION XM_031684582 VERSION XM_031684582.1 DBLINK BioProject: PRJNA221631 KEYWORDS RefSeq. SOURCE Vicugna pacos (alpaca) ORGANISM Vicugna pacos Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Tylopoda; Camelidae; Vicugna. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_021964184.1) annotated using gene prediction method: Gnomon, supported by mRNA evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Vicugna pacos Annotation Release 102 Annotation Version :: 102 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..4289 /organism="Vicugna pacos" /mol_type="mRNA" /isolate="Carlotta (AHFN-0088)" /db_xref="taxon:30538" /chromosome="14" /map="unlocalized" /sex="female" /tissue_type="blood" /dev_stage="adult" gene 1..4289 /gene="ATP7B" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 mRNA, 3 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:102544967" CDS 340..4164 /gene="ATP7B" /codon_start=1 /product="copper-transporting ATPase 2 isoform X5" /protein_id="XP_031540442.1" /db_xref="GeneID:102544967" /translation="
MERAGGEKSGSPEPSFLATLADPQVTLLSVHKRWSFRRSPGARGSIRPVTSEEEGCRPEEGGFSQKVLNGTQEIGSDQILSKLPWTARAWEPEMKQSFAFDNTGYEDGLDGMYPSQTATGTISIAGMTCQSCVQSIEGRVSSLKGIVSIKVSLEQGSAAVKYVPSVLSLPQVCSHIEDMGFEASVAEGKAASWPYRSSPVPEAVVKLRVEGMTCQSCVSSIEGKIGKLQGVVRVRVSLGSREAVITYQPYLIQPQELRDHVNDMGFEAIIKNKGAPMSLGLIDVRRLQSAHPKVPLASSNQNGSNSETSGHRGSQVVTLHLGVDGMHCKSCVLNIEDNIGQLPGVQSIHVSLEDRSAQVQYDPSCISPGALQRAIEALPPGKFKVSLPDGAEESGTEARRHSPGPPQGLPEPGAHWTAVLSIAGMTCMSCVQSIEGLVSQREGVQRISVSLAEGTGMVLYDPSVTSAEELRAAVEDMGFEASVLAENCSSNHVGNYSAESSTGQAGPPRSVQEAAPRPGGLPENHNPGRLSESPPASETAAPQKCFLRITGMTCASCVSNIERNLQKEAGILSVLVALMAGKAEVKYNPGVIQPLEIVQLIQDLGFEAAVMEDCAGSDGDLELIITGMTCTSCVHNIESILTRTNGITYASVALATSKAHVKFDPETIGPRDIVRIIGEMGFRASPAQRNPTAHHLDHKVEIKQWKKSFLCSLVFGIPVMGLMIYMLIPSNEPHESMVLDHNIIPGLSILNLIFFILCTFVQFLGGWYFYVQAYKSLRHRAANMDVLIVLATSIAYIYSLVILVVAIAEKAERSPVTFFDTPPMLFVFIALGRWLEHVTKSKTSEALAKLMSLQATEATVVTLGEDSLIIREEQVPMELVQRGDTIKVVPGGKFPVDGKVLEGSTMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVTATHVGNNTTLAQIVKLVEEAQMSKAPIQQLADRFSGYFVPFIIIISTLTSVVWIVIGFTDFGVVQKYFPTPNKHISQVEVVFRFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITHGVPKVMRVLLLVDMATLPLRKVLAVVGTAEASSEHPLGVAVTRYCKEELGTETMGYCTDFQAVPGCGIGCKVSSVEGILAQGERLQSEQTAHLNGVSSVPVETDAAPQTFSVLIGNREWMRRNGLTVTSDVSDAMTDHEMKGQTAILVAIDDCSRPEDSFAPRPGLRSALLALTWGCLLQVCSVG"
misc_feature 700..891 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(718..726,733..735) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 955..1143 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(973..981,988..990) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1306..1473 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1315..1323,1330..1332) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1594..1785 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1612..1620,1627..1629) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1978..2166 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1993..2001,2008..2010) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 2203..2394 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(2221..2229,2236..2238) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 2458..>4062 /gene="ATP7B" /note="Haloacid Dehalogenase-like Hydrolases; Region: HAD_like; cl21460" /db_xref="CDD:451251" ORIGIN
tacgcggtggccgggcgtccaagcagttctgcgtgtgcgaggggctgtgtacagagattcctagggccaaataaatgcagtgtgatgagtaagaggatgccagttggtttgaggggtgtagataaacaagagcaaatatacatacagcagtgtgcagcctgccctggttcctggaagcctggctggcagcctccccgggctggctcaggggcagggcagcaggtgcctccccctcactagttaggaagacgcttttcaagcgttttcttctgacgtgaccaaatagcccgaagacgaactgctgttgcggcaggtggaggtgtcactgtggacttggcgatggagagagctgggggcgagaagtctgggagccctgagccgtccttcctggcgactctggctgacccacaggtgaccctgttgtctgtccacaaacggtggtccttcaggagaagccctggagcgagaggctccatcaggccagtgacttcggaggaggaaggctgtcgtcctgaggagggaggattttcacagaaggttttgaatggaacacaggagatcggttccgatcagatcctgtctaagcttccctggactgctcgagcctgggagccagagatgaagcagagttttgcctttgacaacactggctatgaggatggcctggacggcatgtacccctctcagacggccaccggcacgatcagcatcgcgggcatgacctgccagtcatgtgtgcagtccatcgagggcagggtctccagtttgaagggcatcgtgagcattaaggtttccctggaacagggcagcgcggccgtgaagtacgtgccgtcagtcctgagcctacctcaggtttgcagtcacatcgaggacatgggcttcgaagccagtgtggcggagggaaaggctgcctcctggccgtacaggtcctcgcccgtcccagaggccgtggtcaagcttcgggtggagggcatgacctgccagtcctgcgtcagctccatagaaggaaagatcgggaaactgcaaggtgtcgtgagggtccgcgtctcgctcggcagccgggaggcggtcatcacttaccagccttaccttattcaaccacaagagctcagagaccatgtaaacgacatggggtttgaagccatcatcaagaacaagggggcccccatgagcctgggactgatcgatgtcagacggctgcagagcgcccacccaaaggtgccgctagcttccagcaatcagaatggcagtaactcagagacctcggggcaccgggggagccaggtggtcaccctgcacctgggcgtggatggaatgcactgtaagtcttgcgtcctgaatatcgaagacaacataggccagctcccaggagttcagagcattcacgtgtccttggaggacagatctgcccaagtgcagtacgacccttcttgcatctccccgggggccctgcagagggccatcgaggctcttccacctgggaagtttaaagtttctcttcctgatggagcagaagagagtggaacagaagccagacgccactcccccgggcccccccagggcctcccagagcccggtgcgcactggaccgcggtgctctccatcgccggcatgacctgcatgtcctgcgtccagtccatcgagggcctggtctcccagagggaaggggtgcagcggatatcggtctctttggctgaagggaccggaatggttctctacgatccgtctgtgactagtgcagaagaactccgagctgccgtggaggacatgggatttgaggcatccgtcctggctgaaaactgttccagcaaccatgttgggaactacagtgctgagagttccacggggcaggctggcccccccaggtctgtgcaggaggcagctccccgccctgggggactccctgaaaaccacaaccccggccgcttgtccgagtccccaccggcctccgagacagcggccccgcagaagtgcttcctacgaatcaccggcatgacctgcgcgtcctgtgtgtccaacatagagagaaacctgcagaaggaagctggtattctctccgtgctggttgccctgatggctgggaaggcagaggtgaagtataacccgggagtcatccagcccctggagatagtgcagctcatccaggacctgggcttcgaggcagcagtgatggaggactgcgcgggctcggacggcgacctggagctgatcatcacagggatgacctgcacctcctgtgttcacaacatagagtccatactcacaaggacaaatggcatcacctacgcctctgtggctctcgccaccagcaaagcccacgtgaagtttgatcctgaaacgatcggcccgcgggatattgtcagaattattggggaaatgggctttcgtgcttccccggcccagaggaaccccaccgctcatcacttggaccacaaggtggagataaagcagtggaagaagtctttcctgtgcagcctggtgttcggcatccctgtcatgggtttaatgatctacatgttgatacccagcaatgagccgcacgagtctatggtcctggaccacaacatcatcccaggactgtccattctcaatctcatcttctttatcttgtgtacctttgtccagttcctcggaggctggtacttctacgttcaggcctacaagtctctgagacacagggcggccaacatggatgtgctcatcgtgctggccacgagcatcgcctacatctactccctggtcatcctggtggtggccatcgctgagaaggccgagaggagccccgtgacgttcttcgacactcctcccatgctcttcgtgttcattgccctcggacggtggctggaacacgtgacaaagagcaaaacctcagaagcccttgccaaactcatgtctctgcaagccacagaagccaccgtcgtgactctcggtgaagacagcttaatcatcagggaggagcaggtgcccatggagctggtgcagcgtggcgataccatcaaggtcgtccccgggggcaagttcccggtggacgggaaagtcctggaaggcagcaccatggccgacgagtccctcatcacaggagaggccatgccggtcaccaagaaacctggcagcacggtgatcgccgggtccataaacgcccacggctctgtgctcgttactgccacccacgtgggcaacaacaccaccctggctcagatcgtgaagttggtggaagaggctcagatgtcaaaggcacccattcagcaactggctgaccggtttagtggatattttgtcccatttatcatcatcatttcaactttgacatcggtggtatggattgtaatcggttttaccgattttggtgttgttcagaaatactttcctacccccaacaagcatatctcccaggtggaggtggtcttccggtttgcgttccagacgtccatcacggtgctgtgcatcgcctgcccctgctccctgggcctggccacgcccacggccgtcatggtgggcaccggcgtggccgcccagaacggcatcctcatcaagggaggcaagcccctggagatggcccacaagataaagactgtgatgtttgacaaaactggcaccattacccatggggtccccaaagtcatgcgggtcctcctgctcgtggacatggccacgctgcccctcaggaaggttctcgctgtggtggggaccgcggaggccagcagtgagcaccccttgggcgtggcagtcaccagatactgtaaagaggaacttggaacagagaccatgggatactgcacggacttccaggcggtgccaggctgcggaatcggctgtaaagtcagcagcgtggagggcatcctggcgcagggcgagcgcctgcagagcgaacagaccgctcacctgaatggggtcagcagcgtccccgtggaaacagatgcggccccacagaccttctctgtgctgatcggaaaccgagagtggatgaggcgcaacggcttgacggtcaccagcgacgtcagcgacgccatgaccgatcacgagatgaagggccagacggccatcctggtggccatcgacgactgttcccgtcctgaggactcatttgctcctcggcctgggctgcgcagtgctctgcttgcacttacctgggggtgtctcctgcaggtgtgctctgtgggatgatcgccatcgcggatgccgtcaagcaggaggccgccctggccgtgcacacactgaagagcatgggtgtggacgtggttctgatcacgggggacaaccgcaagacagccagagccatcgccacccag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]