GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-07 21:28:31, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_031684579            6836 bp    mRNA    linear   MAM 22-NOV-2019
DEFINITION  PREDICTED: Vicugna pacos ATPase copper transporting beta (ATP7B),
            transcript variant X2, mRNA.
ACCESSION   XM_031684579
VERSION     XM_031684579.1
DBLINK      BioProject: PRJNA221631
KEYWORDS    RefSeq.
SOURCE      Vicugna pacos (alpaca)
  ORGANISM  Vicugna pacos
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Cetartiodactyla; Tylopoda;
            Camelidae; Vicugna.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_021964184.1) annotated using gene prediction method: Gnomon,
            supported by mRNA evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Vicugna pacos Annotation Release 102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..6836
                     /organism="Vicugna pacos"
                     /mol_type="mRNA"
                     /isolate="Carlotta (AHFN-0088)"
                     /db_xref="taxon:30538"
                     /chromosome="14"
                     /map="unlocalized"
                     /sex="female"
                     /tissue_type="blood"
                     /dev_stage="adult"
     gene            1..6836
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 5 mRNAs, 6 Proteins, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 5 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:102544967"
     CDS             456..4838
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X2"
                     /protein_id="XP_031540439.1"
                     /db_xref="GeneID:102544967"
                     /translation="
MKPEQERRIIDREEASRRILSKLPWTARAWEPEMKQSFAFDNTGYEDGLDGMYPSQTATGTISIAGMTCQSCVQSIEGRVSSLKGIVSIKVSLEQGSAAVKYVPSVLSLPQVCSHIEDMGFEASVAEGKAASWPYRSSPVPEAVVKLRVEGMTCQSCVSSIEGKIGKLQGVVRVRVSLGSREAVITYQPYLIQPQELRDHVNDMGFEAIIKNKGAPMSLGLIDVRRLQSAHPKVPLASSNQNGSNSETSGHRGSQVVTLHLGVDGMHCKSCVLNIEDNIGQLPGVQSIHVSLEDRSAQVQYDPSCISPGALQRAIEALPPGKFKVSLPDGAEESGTEARRHSPGPPQGLPEPGAHWTAVLSIAGMTCMSCVQSIEGLVSQREGVQRISVSLAEGTGMVLYDPSVTSAEELRAAVEDMGFEASVLAENCSSNHVGNYSAESSTGQAGPPRSVQEAAPRPGGLPENHNPGRLSESPPASETAAPQKCFLRITGMTCASCVSNIERNLQKEAGILSVLVALMAGKAEVKYNPGVIQPLEIVQLIQDLGFEAAVMEDCAGSDGDLELIITGMTCTSCVHNIESILTRTNGITYASVALATSKAHVKFDPETIGPRDIVRIIGEMGFRASPAQRNPTAHHLDHKVEIKQWKKSFLCSLVFGIPVMGLMIYMLIPSNEPHESMVLDHNIIPGLSILNLIFFILCTFVQFLGGWYFYVQAYKSLRHRAANMDVLIVLATSIAYIYSLVILVVAIAEKAERSPVTFFDTPPMLFVFIALGRWLEHVTKSKTSEALAKLMSLQATEATVVTLGEDSLIIREEQVPMELVQRGDTIKVVPGGKFPVDGKVLEGSTMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVTATHVGNNTTLAQIVKLVEEAQMSKAPIQQLADRFSGYFVPFIIIISTLTSVVWIVIGFTDFGVVQKYFPTPNKHISQVEVVFRFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITHGVPKVMRVLLLVDMATLPLRKVLAVVGTAEASSEHPLGVAVTRYCKEELGTETMGYCTDFQAVPGCGIGCKVSSVEGILAQGERLQSEQTAHLNGVSSVPVETDAAPQTFSVLIGNREWMRRNGLTVTSDVSDAMTDHEMKGQTAILVAIDGVLCGMIAIADAVKQEAALAVHTLKSMGVDVVLITGDNRKTARAIATQVGINKVFAEVLPSHKVAKVQELQNEGKRVAMVGDGVNDSPALAQADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVWRIRLNLVLALIYNLVGIPIAAGVFMPIGIVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPELEWYAAQAQGRMKPLTASQVSVHIGMDDRRRDSPRATPWDQVSYISQVSLSSLKSDKLSRHSTAASDRGDKWSLLLNDRDEEQCI"
ORIGIN      
cgtggcctgtgatggacagctggcgttcctaccctcgggcccctcccccactggaagacccctctcgggcgcccccgtcccaagtccagtgtccgccgcccgttagagaccaatgggaggctcttgcgcgtctcggatcgattttcctggttcggagttcactcccgcagccgctgcggcgtctcggacccgcggcacctcggagccaggcgcggagccggagagggagctgcgcagaggagactcgaagcctgcgcccgcagcgccgcaccttccccgcgggcagtgggcgagcctggggatccacatctctaggccgagtctacgcggctcactctcttccatttcctccccggcacgcgccagaggctgaagaccgaggccagagcgcaccagccccagaggtgaccttgggctctgggctgcattacagaagaaattagtgcctcggggagatgaagcccgagcaggagagacggattatagatcgggaagaagccagtcggagaatcctgtctaagcttccctggactgctcgagcctgggagccagagatgaagcagagttttgcctttgacaacactggctatgaggatggcctggacggcatgtacccctctcagacggccaccggcacgatcagcatcgcgggcatgacctgccagtcatgtgtgcagtccatcgagggcagggtctccagtttgaagggcatcgtgagcattaaggtttccctggaacagggcagcgcggccgtgaagtacgtgccgtcagtcctgagcctacctcaggtttgcagtcacatcgaggacatgggcttcgaagccagtgtggcggagggaaaggctgcctcctggccgtacaggtcctcgcccgtcccagaggccgtggtcaagcttcgggtggagggcatgacctgccagtcctgcgtcagctccatagaaggaaagatcgggaaactgcaaggtgtcgtgagggtccgcgtctcgctcggcagccgggaggcggtcatcacttaccagccttaccttattcaaccacaagagctcagagaccatgtaaacgacatggggtttgaagccatcatcaagaacaagggggcccccatgagcctgggactgatcgatgtcagacggctgcagagcgcccacccaaaggtgccgctagcttccagcaatcagaatggcagtaactcagagacctcggggcaccgggggagccaggtggtcaccctgcacctgggcgtggatggaatgcactgtaagtcttgcgtcctgaatatcgaagacaacataggccagctcccaggagttcagagcattcacgtgtccttggaggacagatctgcccaagtgcagtacgacccttcttgcatctccccgggggccctgcagagggccatcgaggctcttccacctgggaagtttaaagtttctcttcctgatggagcagaagagagtggaacagaagccagacgccactcccccgggcccccccagggcctcccagagcccggtgcgcactggaccgcggtgctctccatcgccggcatgacctgcatgtcctgcgtccagtccatcgagggcctggtctcccagagggaaggggtgcagcggatatcggtctctttggctgaagggaccggaatggttctctacgatccgtctgtgactagtgcagaagaactccgagctgccgtggaggacatgggatttgaggcatccgtcctggctgaaaactgttccagcaaccatgttgggaactacagtgctgagagttccacggggcaggctggcccccccaggtctgtgcaggaggcagctccccgccctgggggactccctgaaaaccacaaccccggccgcttgtccgagtccccaccggcctccgagacagcggccccgcagaagtgcttcctacgaatcaccggcatgacctgcgcgtcctgtgtgtccaacatagagagaaacctgcagaaggaagctggtattctctccgtgctggttgccctgatggctgggaaggcagaggtgaagtataacccgggagtcatccagcccctggagatagtgcagctcatccaggacctgggcttcgaggcagcagtgatggaggactgcgcgggctcggacggcgacctggagctgatcatcacagggatgacctgcacctcctgtgttcacaacatagagtccatactcacaaggacaaatggcatcacctacgcctctgtggctctcgccaccagcaaagcccacgtgaagtttgatcctgaaacgatcggcccgcgggatattgtcagaattattggggaaatgggctttcgtgcttccccggcccagaggaaccccaccgctcatcacttggaccacaaggtggagataaagcagtggaagaagtctttcctgtgcagcctggtgttcggcatccctgtcatgggtttaatgatctacatgttgatacccagcaatgagccgcacgagtctatggtcctggaccacaacatcatcccaggactgtccattctcaatctcatcttctttatcttgtgtacctttgtccagttcctcggaggctggtacttctacgttcaggcctacaagtctctgagacacagggcggccaacatggatgtgctcatcgtgctggccacgagcatcgcctacatctactccctggtcatcctggtggtggccatcgctgagaaggccgagaggagccccgtgacgttcttcgacactcctcccatgctcttcgtgttcattgccctcggacggtggctggaacacgtgacaaagagcaaaacctcagaagcccttgccaaactcatgtctctgcaagccacagaagccaccgtcgtgactctcggtgaagacagcttaatcatcagggaggagcaggtgcccatggagctggtgcagcgtggcgataccatcaaggtcgtccccgggggcaagttcccggtggacgggaaagtcctggaaggcagcaccatggccgacgagtccctcatcacaggagaggccatgccggtcaccaagaaacctggcagcacggtgatcgccgggtccataaacgcccacggctctgtgctcgttactgccacccacgtgggcaacaacaccaccctggctcagatcgtgaagttggtggaagaggctcagatgtcaaaggcacccattcagcaactggctgaccggtttagtggatattttgtcccatttatcatcatcatttcaactttgacatcggtggtatggattgtaatcggttttaccgattttggtgttgttcagaaatactttcctacccccaacaagcatatctcccaggtggaggtggtcttccggtttgcgttccagacgtccatcacggtgctgtgcatcgcctgcccctgctccctgggcctggccacgcccacggccgtcatggtgggcaccggcgtggccgcccagaacggcatcctcatcaagggaggcaagcccctggagatggcccacaagataaagactgtgatgtttgacaaaactggcaccattacccatggggtccccaaagtcatgcgggtcctcctgctcgtggacatggccacgctgcccctcaggaaggttctcgctgtggtggggaccgcggaggccagcagtgagcaccccttgggcgtggcagtcaccagatactgtaaagaggaacttggaacagagaccatgggatactgcacggacttccaggcggtgccaggctgcggaatcggctgtaaagtcagcagcgtggagggcatcctggcgcagggcgagcgcctgcagagcgaacagaccgctcacctgaatggggtcagcagcgtccccgtggaaacagatgcggccccacagaccttctctgtgctgatcggaaaccgagagtggatgaggcgcaacggcttgacggtcaccagcgacgtcagcgacgccatgaccgatcacgagatgaagggccagacggccatcctggtggccatcgacggtgtgctctgtgggatgatcgccatcgcggatgccgtcaagcaggaggccgccctggccgtgcacacactgaagagcatgggtgtggacgtggttctgatcacgggggacaaccgcaagacagccagagccatcgccacccaggttggcatcaacaaagtcttcgcagaggtgctgccttctcacaaggtggccaaggtccaggagctccagaacgaggggaagagggtcgccatggtgggcgacggggtcaacgactccccagccctggcccaggccgacgtgggcattgccatcgggacgggcacggatgtcgccatcgaagcggctgacgtcgtcctcatcagaaacgacctgctcgacgtggtggccagcattcacctctccaagaggactgtgtggagaatccgcctcaacctggtgctggcgttgatctacaacctggtcggaatacccatcgcagcaggtgtcttcatgcccatcggcatcgtgctgcagccatggatgggctcggcagctatggcggcctcctccgtgtctgtggtcctctcgtcactgcagctcaagtgctataagaagccggagctggagtggtacgcagcacaggcacagggccgcatgaagcccctgactgcgtcccaggtcagcgtgcacatcggcatggacgaccggcggcgggactccccccgggccacaccctgggaccaggtcagctacatcagccaggtgtccctgtcctccctcaagtccgacaagctgtctcggcacagcactgcggccagtgacagaggggacaagtggtctctgctcctgaatgaccgggatgaggagcagtgcatctgaaagccacaggcaggcgcagaccccggccggcctggcccccctccccgtggccgaggctcgagcccagcaggcgtggcaccagcggccggcagcagggttgtggggcccctctccagccctggtgcttccgctccccgggcctccttgatcatcccgtcctgggcacgtggacggcgctgcctggccccacgggctcaggggaggcgtcctcccccgtgctgtggcggggcttgtcagaagcctgctgggacagccagccctctgctcagcctctgctttagcatttgggatgactgctcgtgacacgaggaagacctcatcaggaccaggaccttagccaggcctttccatggagctaataaaaacctcggggtcgggctcttttttgacgacacccacgtgcaacgtgtatctgagaccagtttacctcaagtgcacccattgtgctctgctggcaccgcctctcccttttctgcccttgacactgggggtgtggcaccccatcatccgaggccagggctgccgtcctcgcttccccgctgctgttctcgggtgcctctccgaggggctcgagtgctcctgcccgcgccccccaactcacacgcccgccggagagctcgccacacgtcctcagggcgagaagagttctttcttgctgctgagcctcttctctgtggagtcgtggcttctcactctgcagaaccgagtgctgttgctgattgtcgctgcccagctggagtgaggtctcagaacctgagacttgagaaatttgtcttcctgtgggatccaggtagacggaccccgggaggcctgtggtgcaggaacctgctggcccagttcctggggcttcagttacatggcctcacagggtccaatacagaattcatggaggtagtaccccaatgtgcagctccgaggaagtggtacccaaataagagagaggacaccccagtcctccacgtgctttgacttctgcacgctgagctggtgccttaggaaaggggtgaccacaacttcccaagggagagtctttctaacttgcagtggcctttgtggttgcatgacattggaggggcaggaacagggccattgtagactctgaggtcggtggtgattggcagaccacacaggggaagactagtatgatcagaatcttagaacaggcagagcagagcctgttcccagttctgagatgaagcctttgtcacacacacacagtcatttgagttatttattaagtgtcagctattttccagggggatacaaacactatttataaattacctctaatcctcccaacaaaccagcaaagtagataatgtccacgtttcacaggggggaacgggctcagagaggctagtgatcttgcccagaatcacacagccagtgtataggccagagcaggggtctgaatccacgtctattggctctgaagtcttttctccaactggcctctacttgaatagtttgcttgataagaatgaacaaggaaaaggcgcttgcacctggaagaagggatctgccaggtgatagattcatggacttggagtgaaattcaatcacaaggtcgtgtcaccttccctcgggatggttcctttccatttccatacagtttagtttttgctgggtcttactctctaaaaatccatgcacagcgctttgttgtgcttttactttccagtcctctctcccctcccagccccttcctgctctgtccccagtcttgtcctctctttactcttggctgtgctgggggtgtttcttgttttgtaactaggctggtcattgtctgaagaatctaattgtattgatttttcaaaaagcttttaggaccataaatgtcatgtttatggggacacaagaatatttatataattgtacggaaaataaccttttagatgttcaaagtataaggaatttttggtcagaaaagaattcctacttcagaaactttccatgctatattagaataaattttctttttttattcatctaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]