LOCUS       XM_031664400            3659 bp    mRNA    linear   PRI 20-NOV-2019
DEFINITION  PREDICTED: Papio anubis nuclear factor kappa B subunit 1 (NFKB1),
            transcript variant X3, mRNA.
ACCESSION   XM_031664400
VERSION     XM_031664400.1
DBLINK      BioProject: PRJNA576697
KEYWORDS    RefSeq.
SOURCE      Papio anubis (olive baboon)
  ORGANISM  Papio anubis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Cercopithecidae; Cercopithecinae; Papio.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_044978.1) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Papio anubis Annotation Release 104
            Annotation Version          :: 104
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3659
                     /organism="Papio anubis"
                     /mol_type="mRNA"
                     /isolate="15944"
                     /db_xref="taxon:9555"
                     /chromosome="3"
                     /sex="male"
                     /tissue_type="whole blood"
     gene            1..3659
                     /gene="NFKB1"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 mRNA, 305 ESTs, 5 Proteins, and
                     100% coverage of the annotated genomic feature by RNAseq
                     alignments, including 15 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:101026781"
     CDS             179..3154
                     /gene="NFKB1"
                     /codon_start=1
                     /product="nuclear factor NF-kappa-B p105 subunit isoform
                     X3"
                     /protein_id="XP_031520260.1"
                     /db_xref="GeneID:101026781"
                     /translation="

MNTLSSCLLENVNFTFIFKSFRMAEDDPYLGRPEQMFHLDPSLTHTIFNPEVFQPQMALPTADGPYLQILEQPKQRGFRFRYVCEGPSHGGLPGASSEKNKKSYPQVKICNYVGPAKVIVQLVTNGKNIHLHAHSLVGKHCEDGICTVTAGPKDMVVGFANLGILHVTKKKVFETLEARMTEACIRGYNPGLLVHPDLAYLQAEGGGDRQLGDREKELIRQAALQQTKEMDLSVVRLMFTAFLPDSTGSFTRRLEPVVSDAIYDSKAPNASNLKIVRMDRTAGCVTGGEEIYLLCDKVQKDDIQIRFYEEEENGGVWEGFGDFSPTDVHRQFAIVFKTPKYKDVNITKPASVFVQLRRKSDLETSEPKPFLYYPEIKDKEEVQRKRQKLMPNFSDSFGGGSGAGAGGGGMFGSGGGGGGTGSTGPGYSFPHYGFPTYGGITFHPGTTKSNAGMKHGTMDTESKKDSEGCDRSDDRNTVNLFGKVIETTEHNQEPSEATDGNGEVTLTYATRAKEESARVQDNLFLEKAMQLAKRHANALFDYAVTGDVKMLLAVQRHLTAVQDENGDSVLHLAIIHLHSQLVRDLLEVTSGLISDDIINMRNDLYQTPLHLAVITKQEDVVEDLLRAGADLSLLDRLGNSVLHLAAKEGHDKVLSILLKHKKAALLLDHPNGDGLNAIHLAMMSNSLPCLLLLVAAGADVNAQEQKSGRTALHLAVEHDNISLAGCLLLEGDAHVDSTTYDGTTPLHIAAGRGSTRLAALLKAAGADPLVENFEPLYDLDDSWENAGEDEGVVPGTTPLDMAASWQVFDILNGKPYEPEFTSDDLLAQGDMKQLAEDVKLQLYKLLEIPDPDKNWATLAQKLGLGILNNAFRLSPAPSKTLMDNYEVSGGTVRELVEALRQMGYTEAIEVIQAASSPVKTTSQAHSLPLSPASTRQQIDELRDSDSVCDSGVETSFRKLSFTESLTSGGSLLTLNKMPHDYGQEGPLEGKI"

     misc_feature    371..976
                     /gene="NFKB1"
                     /note="N-terminal sub-domain of the Rel homology domain
                     (RHD) of nuclear factor of kappa B1 (NF-kappa B1); Region:
                     RHD-n_NFkB1; cd07935"
                     /db_xref="CDD:143651"
     misc_feature    order(413..415,419..424,428..433,440..451,674..676,
                     680..685,974..976)
                     /gene="NFKB1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:143651"
     misc_feature    995..1300
                     /gene="NFKB1"
                     /note="IPT domain of the transcription factor NFkappaB and
                     related transcription factors. NFkappaB is considered a
                     central regulator of stress responses, activated by
                     different stressful conditions, including physical stress,
                     oxidative stress, and exposure to...; Region:
                     IPT_NFkappaB; cd01177"
                     /db_xref="CDD:238582"
     misc_feature    order(998..1000,1004..1012,1016..1024,1142..1150,
                     1187..1189,1223..1225,1280..1282,1289..1291,1295..1297)
                     /gene="NFKB1"
                     /note="ankyrin protein binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:238582"
     misc_feature    order(1004..1009,1013..1015,1052..1054,1058..1060,
                     1064..1066,1163..1168,1175..1177,1181..1183)
                     /gene="NFKB1"
                     /note="dimerization interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:238582"
     misc_feature    order(1067..1069,1073..1075,1166..1171)
                     /gene="NFKB1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238582"
     misc_feature    1739..2521
                     /gene="NFKB1"
                     /note="Ankyrin repeat [Signal transduction mechanisms];
                     Region: ANKYR; COG0666"
                     /db_xref="CDD:440430"
     misc_feature    order(1871..1873,1877..1879,1889..1894,1901..1909,
                     1913..1918,1928..1930,1937..1939,1982..1984,1988..1990,
                     1994..1996,2006..2011,2018..2026,2030..2035,2045..2047,
                     2054..2056,2081..2083,2087..2089,2093..2095,2105..2110,
                     2117..2125,2129..2134,2144..2146,2153..2155)
                     /gene="NFKB1"
                     /note="oligomer interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:293786"
     misc_feature    1871..1984
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    1988..2083
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2195..2287
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2297..2395
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2690..2917
                     /gene="NFKB1"
                     /note="Death domain of the Nuclear Factor-KappaB1
                     precursor protein p105; Region: Death_NFkB1_p105; cd08797"
                     /db_xref="CDD:260063"
ORIGIN      

tcgggctccggccggccaccgcctcttccctctccagcccgcaggcccgcgccgcccaggagggagagacccgcgccaggaggccgaacgcggactcgccaccagggtccaactttctatcatttcccttcagcatgaagaagtttttttagcatgtcttttagcagatctgctggtgatgaatactcttagctcttgtttacttgaaaatgtcaatttcacctttatttttaaaagcttcagaatggcagaagatgatccatatttgggaaggcctgaacaaatgtttcatttggatccttctttgactcatacaatatttaatccagaagtatttcaaccacagatggcactgccaacagcagatggcccatatcttcaaatattagagcaacctaaacagcgaggatttcgtttccgttatgtttgtgaaggcccatcccatggtggactacctggtgcctctagcgaaaagaacaagaagtcttaccctcaggtcaaaatctgcaactatgtgggaccagcaaaggttattgttcagttggtcacaaatggaaaaaatatccacctgcatgcccacagcctggtgggaaaacactgtgaggatgggatctgcactgtaactgctggacccaaggacatggtggttggcttcgcaaacctgggtatacttcatgtgacaaagaaaaaagtatttgaaacactggaagcacgaatgacagaggcgtgtataaggggctataatcctggactcttggtgcaccctgaccttgcctatttgcaagcagaaggtggaggggaccggcaattgggagatcgggaaaaagagctaatccgccaagcagctctgcagcaaaccaaggagatggacctcagcgtggtgcggctcatgtttacagcttttcttccggatagcactggcagcttcacaaggcgcctggaacccgtagtatcagacgccatctatgacagtaaagcccccaacgcatccaacttgaaaattgtaagaatggacaggacagctggatgtgtgactggaggggaggaaatttatcttctctgtgacaaagttcagaaagatgacatccagattcgattttatgaagaggaggaaaatggtggagtctgggaaggatttggagatttttcccccacagatgttcatagacaatttgccatcgtcttcaaaactccaaagtataaagatgttaatattacaaaaccagcctctgtgttcgtccagcttcggaggaaatctgacttggaaactagtgaaccaaaacctttcctctactatcctgaaatcaaagataaagaagaagtacagaggaaacggcagaagctcatgcccaatttttcggatagtttcggcggtgggagtggcgctggagctggaggcggaggcatgtttggtagtggcggtggaggagggggcactggaagtacagggccagggtatagcttcccgcactatggatttcctacttatggtgggattaccttccatcctggaactactaaatctaatgctgggatgaagcatggaaccatggacactgaatctaaaaaggactctgaaggttgtgacagaagtgatgacagaaacactgtaaacctctttgggaaagtcattgaaaccacagagcacaatcaggagcccagcgaggccactgatgggaatggtgaggtcactctaacgtatgcaacaagagcaaaagaagagagtgctagggttcaggataacctctttctagagaaggctatgcagcttgcaaagaggcatgccaatgcccttttcgactacgcagtgacaggagacgtgaagatgctgctggctgtccagcgccatctcactgccgtgcaggatgagaatggggacagtgtcttacacttagcaatcatccaccttcattctcaacttgtgagggatctactagaagtcacatctggtttgatttctgatgacattatcaacatgagaaatgacctgtaccagacgcccttgcacttggcagtgatcactaagcaggaagatgtggtggaggatttgctgagggctggggccgacctgagccttctggaccgcttgggtaactctgttttgcacctagctgccaaagaaggacatgataaagttctcagtatcttactcaagcacaaaaaggcagcactacttcttgaccaccccaatggggacggtctgaatgccattcatctagccatgatgagcaatagcctgccatgtttgctgctgctggtggccgctggggccgacgtcaatgctcaggagcaaaagtccgggcgcacagcactgcacctggctgtggagcacgacaacatctcattggcaggctgcctgctcctggagggtgatgcccatgtggacagtactacctacgatggaaccacacccctgcatatagcagctgggagagggtccaccaggctggcagctcttctcaaagcagcaggagcagatcccctggtggagaactttgagcctctctatgacctggatgactcttgggaaaatgcaggagaggatgaaggagttgtgcctggaaccacgcctctagatatggccgccagctggcaggtatttgacatattaaatgggaaaccatatgaaccagagtttacatctgatgatttactagcacaaggagacatgaaacagctggctgaagatgtgaagctgcagctctataagttgctagaaattcctgatccagacaaaaactgggctactctggcacagaaattaggtctggggatacttaataatgccttccggctgagtcctgctccttccaaaacacttatggacaactatgaggtctctggggggacagtcagagagctggtggaggccctgagacaaatgggctacactgaagcgattgaagtgatccaggcagcctccagcccagtgaagaccacctctcaggcccactcgctgcctctctcgcctgcctccacaaggcagcaaatagatgagctccgagacagcgacagtgtctgcgacagcggcgtggagacgtccttccgcaaactcagctttactgagtctctgaccagtggtggctcactgctaactctcaacaaaatgccccatgattatgggcaggaaggacctctagaaggcaaaatttagcctgcagacaatttcccacaccgtataaaccaaagccctaaaattctactgcattgtccacaaaacagaagctgaagcgcatccagaggtgctcagagagccggcctgcctgcatcattctcgatagaactcgagaccttttcaacttggcttcctttcttggttcataaatgaattttagtttggttcacttacagatagtatctagcaatcacagcactggctgagcggatgcatctggggatgaggttgcttactaagctttgccggctgctgccggatcacagctgctttctgttgtcattgctattgtccctctgctacgttcctattgtcattaaaggtatcactgtccccacctggcattccttctgaccatccacagcatcgttttgcattcaaattaagggttaagaaaagggatattttaaaatgagagtcacttgacgtgccatttttaaaaaaggcatattgctttttctaatgtggttatttctctgatttg

//