GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 03:26:21, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_031655864            7465 bp    mRNA    linear   PRI 20-NOV-2019
DEFINITION  PREDICTED: Papio anubis ATPase copper transporting beta (ATP7B),
            transcript variant X3, mRNA.
ACCESSION   XM_031655864
VERSION     XM_031655864.1
DBLINK      BioProject: PRJNA576697
KEYWORDS    RefSeq.
SOURCE      Papio anubis (olive baboon)
  ORGANISM  Papio anubis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Cercopithecidae; Cercopithecinae; Papio.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_044990.1) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Papio anubis Annotation Release 104
            Annotation Version          :: 104
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..7465
                     /organism="Papio anubis"
                     /mol_type="mRNA"
                     /isolate="15944"
                     /db_xref="taxon:9555"
                     /chromosome="15"
                     /sex="male"
                     /tissue_type="whole blood"
     gene            1..7465
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 mRNA, 111 ESTs, 4 Proteins, and
                     100% coverage of the annotated genomic feature by RNAseq
                     alignments, including 4 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:101006616"
     CDS             825..5420
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X2"
                     /protein_id="XP_031511724.1"
                     /db_xref="GeneID:101006616"
                     /translation="
MDSAMEKARGDVPQSPEQSFLATLSDPHVTLLSVHKQWSFRKSPGVRHSARPVSTMEEGTSLSEEGEFPQRVLNGTWKMSSNQILSKLSLPTRAWEPAMKKSFAFDNVGYEGGLDGLGPSSQVDTSTIRILGMTCQSCVKSIEDRISSLKGIVSMKVSLEQGSATVKYVPSVVSLQQVCHQIGDMGFEASIAEGKAASWPSRSLPAQEAVVKLRVEGMTCQSCVGSIEGKVRKLQGVVRVKVSLSNQEAVITYQPYLIQPEDLRDHVNDMGFEAAIKNKVAPLSLGPIDIERLESTNPKRPLSSANQNFNNSETLGHQGRNVVTLQLRIDGMHCKSCVLNIEENIGQLLGVQSIQVSLENKTAQVQYDPSRTSPVALQTAIEALPPGNFKVSLPDGAEGSGTDHRSSSSRSPGSSPRNQVQSTCSTTLIAIAGMTCASCVHTIEGMISQLEGVQQISVSLAEGIGTVLYNPSVISPEELRAAIEDMGFEASVVSENCSTSPLGDHSAGNSMVQTTGGTPTSVQEVALHAGSLPTNHLPDIWAKSPQSTRAVAPQKCFLQIKGMTCASCVSNIERNLQKEAGVLSVLVALMAGKAEVKYDPEVIQPLEVAQLIQDLGFEAAVMEDSAGSDGNIELTITGMTCASCVHNIESKLTRTNGITYASVALATSKALVKFDPEIIGPRDIIKIIEEIGFHASLAQRIPNAHHLDHKMEIKQWKKSFLCSLVFGIPVMALMIYMLIPSNQPHQSMVLDRNIIPGLSILNLIFFILCTFVQVLGGWYFYVQAYKSLRHRSANMDVLIVLATSIAYVYSLVILVVAVAEKAERSPVTFFDTPPMLFVFIALGRWLEHLAKSKTSEALAKLMSLQATEATVVTLGEDNLIIREEQVPMELVQRGDIVKVVPGGKFPVDGKVLEGNTMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLIKATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADRFSGYFVPLIIIMSTLTLVVWIVIGFIDFGVVQKYFPNPNKHISQTEVIIRFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITHGVPRVMRVLLLGDVATLPLRKVLAVVGTAEASSEHPLGVAVTKYCKEELGTETLGYCTDFQAVPGCGIGCKVSNVEGILAHSERPLSAPASHLNEAGNLPAEKDAAPQTFSVLIGNREWLRRNGLTISSDVSDAMTDHEMKGQTAILVAIDGVLCGMIAIADAVKQEAALAVHTLQSMGVDVVLITGDNRKTARAIATQVGINKVFAEVLPSHKVAKVQELQNEGKRVAMVGDGVNDSPALAQADMGVAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRIVRRIRINLVLALIYNLVGIPIAAGVFMPIGIVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDLERYEAQAHGHMKPLTASQVSVHIGMDDRRRDSPRATPWDQVSYVSQVSLSSLTSDKPSRHSTAADDGGDKWSLLLNDRDEEQYI"
ORIGIN      
ccgacagaggaggctgctgctggaattaccacagtgtcgtgtgtctcctcctattaatccccatgtggaacagcgggtagcttgagaagcctgaattgtgccttagttcctggctgtggtgctgcttaaacagacgagccttgttagccagtgagtttgtgcagtcagttcttactgaagtcaagcctttggtccaagggaaaacaaagctacaggaaacatggaactttcttgcaccttcttgaaaatgcaagtcatgttgcctaggaaatacttctctcaccaagtattctgcaccctgccaacattggaactgtggaagaggcagctgaagctattccaagaaagtgctagcagtttggtaataaaaggaagtggcatatctctcctgcctctagactgggtttctagaagtgcacatggccaaaaggcaactgcactctgtgctgcactctggcaggtgattacatgctgtcctcatggacaccttggccgggtgtccagtctgcgctgggtgagggtgtacacggaccatgtgcaaagatctacagtgctgcacgcagtgtgttgagcaagagggtgccaagtgctgggacgggtgtagataaacaaaagcaaataggtgcagtactgtgcagcctgcccaagttctcaaagcttgctgccagactgaagactgccggcagcctctcctgggctgggtcaggagtagaagggtgtcttccccttgctaattaggagggcacttctaaagcatttctctctaacacaaccaaatggtctgctgaaggtgaactgctttagtgaggagggaaggcgtgaccatggactcagcgatggagaaagccaggggtgatgtgccccagagccccgagcagtccttcctggcaactctgagtgacccacatgtgaccctgctgtctgtccacaagcagtggtcctttaggaagagccctggggttaggcactcagccaggccagtgtctaccatggaggaaggcacttcactgtcagaggaaggagaatttccacagagagttttgaatggaacctggaaaatgagttccaatcagatcttatctaagctttctttgcctacccgtgcctgggaaccagcaatgaagaagagttttgcttttgacaatgttggctacgaaggtggtctggatggcctgggcccttcttctcaggtggacaccagcacaatcaggatcttgggcatgacttgccagtcatgtgtgaagtccattgaggacagaatttccagtttgaaaggcatcgtgagcatgaaggtttccctggaacaaggcagtgccactgtgaaatatgtgccatcagttgtgagcctgcaacaggtttgccatcaaattggggacatgggcttcgaggccagcattgcagaaggaaaggcagcctcctggccctcaaggtccttgcctgcccaggaggctgtggtcaagctccgggtggagggcatgacctgccagtcctgtgtcggctccattgaaggcaaggtccggaaactgcaaggagtagtgagagtcaaagtctcactcagcaaccaagaggctgtcatcacttatcagccttatctcattcagcctgaagacctcagggaccatgtaaatgacatgggatttgaagctgccatcaagaacaaagtggctcccttaagcctgggaccaattgatattgagcggttagaaagcactaacccaaagagacctttatcttctgctaaccagaattttaataattctgagaccttgggacaccaaggaaggaatgtggtcaccctccaactgagaatagatggaatgcactgtaagtcttgcgtcttgaatattgaagaaaatattggccaactcctaggggttcaaagtattcaagtgtccttggagaacaaaactgcccaagtacagtatgacccttctcgtaccagcccagtggctctgcagacggctatcgaggcacttccacctgggaactttaaagtttctcttcctgatggagccgaagggagtgggacagatcacaggtcttccagttctcgttcccctggctcctccccaagaaaccaggtgcagagcacatgcagtaccactctgattgccattgccggcatgacctgtgcatcctgtgtccataccattgaaggcatgatctcccaactggaaggggtgcagcaaatatcggtgtctttggccgaagggattggaacagttctttataatccctctgtaattagcccagaagaactcagagctgctatagaagacatgggatttgaggcttcagtcgtttctgaaaactgttctactagccctcttggagaccacagtgctgggaattccatggtgcaaactacaggtggtacacctacatctgtgcaggaagtggctctccacgctgggagtctccctacaaaccatctcccggacatctgggcaaagtccccacaatcaaccagagcagtggcaccgcagaagtgcttcttacagatcaaaggcatgacctgtgcgtcctgtgtgtccaacatagaaaggaatctgcagaaggaagctggtgttctctccgtgttggttgccttgatggcaggaaaggcagaggtcaaatatgacccggaggtcattcagccgctcgaggtagctcagttgatccaggacctgggctttgaggcagcagtcatggaggactccgcaggctccgatggcaacattgagctgacaatcacagggatgacctgcgcgtcctgtgtccacaacatagagtccaaactcacgaggacgaatggcatcacttatgcctccgttgcccttgccaccagcaaagcccttgttaagtttgacccggaaattatcggtccacgggatattatcaaaattattgaggaaattggctttcatgcttccctggcccagagaatccccaacgctcatcacttggaccacaagatggaaataaagcagtggaagaagtctttcctgtgcagcctggtgtttggcatccctgtcatggccttaatgatctatatgctgatacccagcaaccagccccaccagtctatggtcctggaccgcaacatcattccaggactgtccattctaaatctcatcttctttatcttgtgcacctttgtccaggtccttggcgggtggtacttctacgttcaggcctacaaatctctgagacacaggtcagccaacatggacgtgctcatcgtcctggccacgagcattgcttacgtctattctctggtcatcctggtggttgctgtggccgagaaggcggagaggagccctgtgacattcttcgacacgccccccatgctcttcgtgttcattgccctggggcggtggctggaacacttggcaaagagcaaaacctcagaagccctggccaaactcatgtctctccaagccacagaagccaccgttgtgacccttggtgaggacaatttaatcatcagggaggagcaagtccccatggagctggtgcagcggggcgatatcgtcaaggtggtccctgggggaaagttcccagtggacgggaaagtcctggaaggcaataccatggctgatgagtccctcatcacaggagaagccatgccagtcactaagaaacccggaagcactgtaattgcggggtctataaatgcacatggctctgtgctcattaaagccacccatgtaggcaatgacaccactttggctcagattgtgaaactggtggaagaggctcagatgtcaaaggcccccattcagcaactggctgaccggtttagtggatattttgtcccacttatcatcatcatgtcaactttgacgttggtggtatggattgtaatcggttttatcgattttggtgttgttcagaagtactttcctaaccccaacaagcacatctcccagacagaggtgatcatccggtttgcattccagacgtccatcacggtgctgtgcattgcctgcccctgctccttggggctggccacgcccacggccgtcatggtgggcactggggtggccgcgcagaatggcatcctcatcaagggaggcaagcccctggagatggcgcacaagataaagactgtgatgtttgacaagactggcaccattacccatggggtccccagggtcatgcgagtgctccttctgggggatgtggccaccctgcccctcaggaaggttctggctgtggtggggactgcggaggccagcagcgaacaccccttgggcgtggcagtcaccaaatactgtaaagaggaacttggaacagagaccttgggatactgcacggacttccaggcggtgccaggctgtggaattgggtgcaaagtcagcaacgtggaaggcatcctggcccacagtgagcgccctttgagtgcacctgccagtcacctgaatgaggctggcaaccttcccgcagaaaaagatgcagccccccagaccttctctgtgctgattggaaaccgtgaatggctgaggcgcaacggcttaaccatttccagtgacgtcagtgacgctatgacagaccacgagatgaaaggacagacagccatcctggtggctattgacggtgtgctctgtgggatgattgctatcgcagatgctgtcaagcaggaggccgccctggctgtgcacacgctgcaaagcatgggtgtggacgtggttctgatcaccggggacaaccggaagacagccagagccattgccacccaggttggcatcaacaaagtctttgcagaggtgctgccttcgcacaaggtggccaaggtccaggagctccagaatgaagggaagagagtcgccatggtgggggatggggtcaatgactccccagccttggctcaggcagacatgggtgtcgccattggcactggcacggatgtggccatcgaggcagccgacgttgtcctcatcagaaatgatttgctggatgtggtggctagcattcacctttccaagaggattgtccggaggatacgcatcaacctggtcctggcactgatttataacctggttgggatacccatcgcggcaggtgtcttcatgcccatcggcattgtgctgcagccctggatgggctcagcagccatggccgcctcctctgtgtctgtggtgctgtcatccctgcagctcaagtgctataagaagcctgacctggagaggtatgaggcacaggcgcatggccacatgaagcccctgacagcatcccaggtcagtgtgcacatcggcatggatgacaggcggcgggactcccccagggccacaccatgggaccaggtcagctatgtcagccaggtgtcgctgtcctccctgacatccgacaagccatctcggcacagcactgcagcggacgatggtggggacaagtggtctctgctcctgaatgacagggatgaggagcagtacatctgatggcaccaggcaggcgggccagggcagggccttgcctccactcgccacaagctgagcaggacagccagcagcaggatgggctgagctagcctccagctttggggacttccactccctggatatgtccagtcatcctgccctgcagcacgtggccttatctgagtgcaactggccttgccctagagaggacggcctggcctgcctcttggcgtcactgaaccgtcaggatgggctttgtcttggactctagtccttggctgtactgtagaaggtgagaggcgagtcaccctcctcacaaacctctgcttggagtatttaggatgactgctatgaaatggagaacagtttcatcaggaccaaaaaacctcactgggcctttccagagaacggcagacctcactgtcaggctctttctgatgacgcctgtctgtgtgcatcatgtttctgagaccacagtttacctcaggtgtgcctgctgctttcttcctgcacagtctgttccttttctcttctgtgtgcttgtccgtggggaccccttggaaccctgcctgtctcctaggagggcgagaccaatgtccttgtggtccttgctgctgctctcaggcgcttctccggtgctctagagtgtgcatttcagcttgaacctgcttcctggctcgcacatccccagccagggagcttgccacaccattcttcaggtccaggagagttctttttttgtttgaagcccccttctccatggggtgggggcttctcagtagagtgttgttgctgaccagctgacctgagagtccagacttggcttcctgtggggtctaggttctcgcaattcaggacgtccttccatattcctgcccagcctgtggtgctgaaaacgtttgtcccatgggagacatgtgtgtgcaggagcctccctgcatggccccaggagcttcgttctcagtcttctgtgtgactgtcacctcatggggttcaatagagaattcatgtcactagcacctggccttgtgtggcttggagattaggtactgcccaaataggaggaaagcacagcctccttgagcctaccttctgcacgcacaggggcttcaggaaaggagtggccacagcatcccgaagggagcatctgtttacctggccgtggctctcagagcagcagaaggggtccagttttagactctgaagttggttgtgattgacagaaccccttgggagcaaactagtagatgttggattaaattctgggtgaaacccttttctcccacacaaaatagttttagtgacttttttcagtgtccattacttgccaggggcagttttagcagcactttcgatagattacctctaatcttcccaaccaaccaacaaggtagctattactgtccgcattttacaggcaaggaaacaggctccaagaggctgaggactttgcccaggatgacatagccagtggacaagccgtgtctgtcagctgtgaaggcttcactctaattgtccttctaccttgaatagaagttttcctgataagaataaacaaggaaaaggtccttgcctcctggaagaacgaatctaccaggtgatctattcattgtttcaactcagaatgcaattcattcaggaggtcatctgaccttcaccttggatggttagtttcactttttacatatagtttttgcggggttttattttataaaatccaagcgccccagtgattgtgttttcattgttttcagccccccaactccagcccgcagcacatttccgctgtccatcagtaactgtgtcctctctttatgcttgcttggggaatgttgttttctgactaggctgatcattatctaaagaatctaattctgttgatttttaaaacttttaggaccataaacgttgtgttcctatatggacatggaaatatttatataattttatagaaaataaccttttagatggtcaaagtgtaaggaatttttttgtcagataaccatttctacttcaaaaacatttcatgcaatattagaataaagttcttgtcattcctctcaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]