GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-27 00:20:46, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_031465954            4496 bp    mRNA    linear   MAM 23-OCT-2019
DEFINITION  PREDICTED: Camelus dromedarius ATPase copper transporting beta
            (ATP7B), transcript variant X3, mRNA.
ACCESSION   XM_031465954
VERSION     XM_031465954.1
DBLINK      BioProject: PRJNA565028
KEYWORDS    RefSeq.
SOURCE      Camelus dromedarius (Arabian camel)
  ORGANISM  Camelus dromedarius
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Tylopoda;
            Camelidae; Camelus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_044524.1) annotated using gene prediction method: Gnomon,
            supported by mRNA evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Camelus dromedarius Annotation
                                           Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4496
                     /organism="Camelus dromedarius"
                     /mol_type="mRNA"
                     /isolate="Drom800"
                     /isolation_source="isolated from an animal called Varis"
                     /db_xref="taxon:9838"
                     /chromosome="14"
                     /sex="female"
                     /tissue_type="blood"
                     /dev_stage="adult"
                     /country="Austria: Eithental"
                     /collection_date="13-Jan-2013"
                     /collected_by="Pamela Burger"
                     /breed="African"
     gene            1..4496
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 4 mRNAs, 21 Proteins, and 99%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 3 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:105090992"
     CDS             155..4489
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X3"
                     /protein_id="XP_031321814.1"
                     /db_xref="GeneID:105090992"
                     /translation="
MQILSKLSWTARAWEPEMKQSFAFDNTGYEDGLDGMCPSQTATGTISIAGMTCQSCVQSIEGRVSSLKGIVSIKVSLEQGSAAVKYVPSVLSLPQVCSHIEDMGFEASVVEGKAASWPYRSSPVPEAVVKLRVEGMTCQSCVSSIEGKIGKLQGVVRVRVSLGSREAVITYQPYLIQPQELRDHVNDMGFEAIIKNKGAPMNLGLIDVRRLQSAHPNVPLASSNQNGSNSETSGHRGSQVVTLHLGVDGMHCKSCVLNIEDNIGQLPGVQSIHVSLEDRSAQVQYDPSCISPGALQRAIEALPPGKFKVSLPDGAEESGTEARRRSPGPPKGLPEPGAHWTAVLSIAGMTCMSCVQSIEGLVSQREGVQWISVSLAEGTGMVLYDPSVTSAEELRAAVEDMGFEASVLAENHSSNHVGNHSAESSTGQAGPPVSVQEAAPHPGALPENHNPGRLSESPPASETAAPQKCFLRITGMTCASCVSNIERNLQKEAGILSVLVALMAGKAEVKYNPGVIQPLEIVQLIQDLGFEAAVMEDYAGSDSDLELIITGMTCTSCVHNIESRLTRTNGITYASVALATSKAHVKFDPETIGPRDIVRIIGEMGFRASPAQRNPTAHHLDHKVEIKQWKKSFLCSLVFGIPVMGLMIYMLIPSNEPHESMVLDHNIIPGLSILNLIFFILCTFVQFLGGWYFYVQAYKSLRHRAANMDVLIVLATSIAYIYSLVILVVAIAEKAERSPVTFFDTPPMLFVFIALGRWLEHVTKSKTSEALAKLMSLQATEATVVTLGEDSLIIREEQVPMELVQRGDTIKVIPGGKFPVDGKVLEGSTMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVTATHVGNNTTLAQIVKLVEEAQMSKAPIQQLADRFSGYFVPFIIIISTLTSVVWIVIGFIDFGVVQKYFPTPNKHISQVEVVFRFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITHGVPKVMRVLLLVDMATLPLRKVLAVVGTAEASSEHPLGVAVTRYCKEELGTETMGYCTDFQAVPGCGIGCKVSSVEGILAQGERLQNERTAHLNGVSSIPVETDAAPQTFSVLIGNREWMRRNGLTVTSDVSDAMTDHEMKGQTAILVAIDGVLCGMIAIADAVKQEAALAVHTLKSMGVDVVLITGDNRKTARAIATQVGINKVFAEVLPSHKVAKVQELQNEGRRVAMVGDGVNDSPALAQADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVWRIRLNLVLALIYNLVGIPIAAGVFMPIGVVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPELEWYAAQAQGRMKPLTASQVSVHIGMDDRRRDSPRATPWDQVSYISQVSLSSLKSDKLSRHSTAANDRGDKWSLLLNDRDEEQCI"
     misc_feature    287..478
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(305..313,320..322)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    542..730
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(560..568,575..577)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    893..1060
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(902..910,917..919)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1181..1372
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1199..1207,1214..1216)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1565..1753
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1580..1588,1595..1597)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1790..1981
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1808..1816,1823..1825)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2045..4153
                     /gene="ATP7B"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(3038..3040,3044..3046,4082..4084)
                     /gene="ATP7B"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(3170..3178,3380..3382,3533..3541,3629..3631,
                     3749..3757,3815..3817,3824..3826,3833..3835,3890..3892,
                     3899..3901)
                     /gene="ATP7B"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      
gtctgaggacaagccccttttctgttgggacatggaagtattatttaacatactgggtgagatcgagttttgaaaatatctgggttttggagagctgctaattttgtaggtgaatggaaagttagctctccggtggtgccattattcacaaaagatgcagatcctgtctaagctttcctggactgctcgagcctgggagccagagatgaagcagagttttgcctttgacaacactggctatgaggatggcctggacggcatgtgcccctctcagacggccaccggcacgatcagcatcgcgggcatgacctgccagtcgtgtgtgcagtccatcgagggcagggtctccagtttgaagggcatcgtgagcattaaggtttccctggaacagggcagcgcggctgtgaagtacgtgccgtcggtcctgagcctacctcaggtttgcagtcacatcgaggacatgggatttgaagccagcgtggtggagggaaaggctgcctcctggccatacaggtcctcgcccgtcccagaggccgtggtcaagcttcgggtggagggcatgacctgccagtcctgcgtcagctccatagaaggaaagatcgggaaactgcaaggtgtcgtgagggtccgcgtttcgctcggcagccgggaggcagtcatcacttaccagccttaccttattcaaccccaagagctcagggaccatgtgaacgacatggggtttgaagccatcatcaagaacaagggggcccccatgaacctgggactgatcgatgtcagacggctgcagagcgcccacccaaatgtgccgctagcttccagcaatcagaatggcagtaactcagagacctcggggcaccgggggagccaggtggtcaccctgcacctgggcgtggatgggatgcactgtaagtcttgtgtcctgaatatcgaagacaacataggccagctcccaggagttcagagcattcatgtgtccttggaggacagatctgcccaagtgcagtacgacccttcttgcatctccccgggggccctgcagagggccatcgaggctcttccacctgggaagtttaaagtttctcttcctgatggagcagaagagagtggaacagaagccagacgccgctcccctgggccccccaagggcctcccagagcccggtgcgcactggaccgcggtgctctccatcgccggcatgacctgcatgtcctgcgtccagtccatcgagggcctggtctcccagagggaaggggtgcagtggatatcggtctctttggctgaagggaccggaatggttctctacgatccgtctgtgactagcgcagaagaactccgagctgccgtggaggacatgggatttgaggcgtccgtcctggctgaaaaccattccagcaaccatgttgggaaccacagtgctgagagttccacggggcaggctggcccccccgtgtctgtgcaggaggcagctccccaccctggggcactccctgaaaaccacaaccctggccgcttgtccgagtccccaccggcctccgagacagcggccccgcagaagtgcttcctacgaatcaccggcatgacctgtgcgtcctgtgtgtccaacatagagagaaacctgcagaaggaagctggtattctctccgtgctggttgccctgatggctgggaaggcagaggtgaagtataacccaggagtcatccagcccctggagatagtgcagctcatccaggacctgggcttcgaggcagcagtgatggaggactacgcgggctcggacagcgacctggagctgatcatcacggggatgacctgcacctcctgtgttcacaacatagagtccagactcacaaggacaaacggcatcacctatgcctctgtggctctcgccaccagcaaagcccatgtgaagtttgatcctgaaacgatcggcccgcgggatattgtcagaattattggggaaatgggctttcgtgcttccccggcccagaggaaccccaccgctcatcacttggaccacaaggtggagataaagcagtggaagaagtctttcctgtgcagcctggtgtttggcatccctgtcatgggtttaatgatctacatgttgatacccagcaacgagccgcatgagtctatggtcctggaccacaacatcatcccaggactgtccatcctcaatctcatcttctttatcttgtgtacctttgtccagttcctcggaggctggtacttctacgttcaggcctacaagtctctgagacacagggcggccaacatggatgtgctcatcgtgctggccacgagcattgcctacatctactccctggtcatcctggtggtggccatcgctgagaaggccgagaggagccccgtgacgttcttcgacaccccccccatgctcttcgtgttcattgccctcggacggtggctggaacacgtgacaaagagcaaaacgtcagaagcccttgccaaactcatgtctctgcaagccacggaagccaccgtcgtgactcttggcgaagacagcttaatcatcagggaggagcaggtgcccatggagctggtgcagcgcggcgataccatcaaggtcatccccgggggcaagttcccggtggacgggaaagtcctggaaggcagcaccatggccgacgagtccctcatcacaggagaggccatgccggtcaccaagaaacctggcagcacggtgatcgccgggtccataaacgcccacggctctgtgctcgttactgccacccacgtgggcaacaacaccaccctggctcagatcgtgaagctggtggaagaggctcagatgtcaaaggcacccattcagcaactggctgaccggtttagtggatattttgtcccatttatcatcatcatttcaactttgacgtcggtggtatggattgtaatcggttttatcgattttggtgttgttcagaaatactttcctacccccaacaagcatatctcccaggtggaggtggtcttccggtttgcattccagacgtccatcacggtgctgtgcatcgcctgcccctgctccctgggcctggccacgcccacggccgtcatggtgggcaccggcgtggccgcccagaatggcatcctcatcaagggaggcaagcccctggagatggcccacaagataaagactgtgatgtttgacaaaactggcaccattacccatggggtccccaaagtcatgcgggtcctcctgctcgtggacatggccacactgcccctcaggaaggttctcgctgtggtggggaccgcggaggccagcagtgagcaccccttgggcgtggcagtcaccagatactgtaaagaggaacttggaacagagaccatgggatactgcacggacttccaggcggtgccaggctgtgggatcggctgtaaagtcagcagcgtggagggcatcctggcgcagggcgagcgcctgcagaacgaacggaccgctcacctgaatggggtcagcagcatccccgtggaaacagatgcggccccgcagaccttctctgtgctgatcggaaaccgggagtggatgaggcgcaacggcttgacggtcaccagcgacgtcagcgacgccatgaccgatcacgagatgaagggccagacggccatcctggtggccatcgacggtgtgctctgtgggatgatcgccatcgcggatgccgtcaagcaggaggccgccctggccgtgcacacgctgaagagcatgggtgtggacgtggttctgatcacgggggacaaccgcaagacagcgagagccatcgccacccaggttggcatcaacaaagtctttgcagaggtgctgccttctcacaaggtggccaaggtccaggagctccagaacgaggggaggagggtcgccatggtgggcgacggggtcaacgactccccagccctggcccaggccgacgtgggcattgccatcgggacgggcacggatgtcgccatcgaagcggctgacgtcgtcctcatcagaaacgacctgctcgacgtggtggccagcattcatctctccaagaggactgtgtggagaatccggctcaacctggtgctggcgttgatctacaacctggtcgggatacccatcgcagcaggtgtcttcatgcccattggtgtcgtgctgcagccatggatgggctcggcagccatggcggcctcctccgtgtctgtggtcctctcgtcactgcagctcaagtgctataagaagccggagctggagtggtacgcggcgcaggcacagggccgcatgaagcccctgaccgcgtcccaggtcagcgtgcacattggcatggacgaccggcggcgggactccccccgggccacaccctgggaccaggtcagctacatcagccaggtgtccctgtcctccctcaagtccgacaagctgtctcggcacagcactgcggccaatgacagaggggacaagtggtctctgctcctgaatgaccgggatgaggagcagtgcatctgaaagccgc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]