GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 05:14:35, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_031047719            6430 bp    mRNA    linear   VRT 04-OCT-2019
DEFINITION  PREDICTED: Melopsittacus undulatus ATPase copper transporting beta
            (LOC101881860), transcript variant X2, mRNA.
ACCESSION   XM_031047719
VERSION     XM_031047719.1
DBLINK      BioProject: PRJNA197262
KEYWORDS    RefSeq.
SOURCE      Melopsittacus undulatus (budgerigar)
  ORGANISM  Melopsittacus undulatus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria;
            Aves; Neognathae; Psittaciformes; Psittacidae; Melopsittacus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_004848250.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Melopsittacus undulatus Annotation
                                           Release 103
            Annotation Version          :: 103
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..6430
                     /organism="Melopsittacus undulatus"
                     /mol_type="mRNA"
                     /db_xref="taxon:13146"
                     /chromosome="Unknown"
                     /sex="male"
     gene            1..6430
                     /gene="LOC101881860"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 3 ESTs, 3 Proteins, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 1 sample with support for all
                     annotated introns"
                     /db_xref="GeneID:101881860"
     CDS             124..4413
                     /gene="LOC101881860"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X2"
                     /protein_id="XP_030903579.1"
                     /db_xref="GeneID:101881860"
                     /translation="
MKHSFAFDNMGYEDSFETGPSSSSQEHTVAVNIVGMTCQSCVQSIEGRISKVKGIVSIKVSLEQNNAVIKYLKSDISAEQICKEIQDMGFDANIAEERLTTAAVNLSCLKEAVVKLRVEGMTCQSCATNIEGKMRKLHGVAKVKVSLGNQEAIIAYYPYIIQPDDLKNHISNLGYECTIKSKSAPLKLGVLDLERLQNANPKETPASLESNGVDPRFTKMNSTATVVLHVEGMHCNSCVRNIEGNISDLPGIQSIKVSLEHKSAVVQYSSNLITLSALQQAIESLPPGNFKVCLLNGSETNKEASPSPASQQNLFREPLQDMTCTAVVRIDGMTCSSCVQSIEGTISQRQGVQRIAVSLAGRTGTIHYDPSVTNGEELKAAIEDMGFDVSILTDTATGEHKPDTSKAAVQPQAPDPPLRDCSSDAAQDRPHRDGPNQPSGAIAGKCFLQITGMTCASCVSTIERNLQKQDGIVSVLVALMAGKAEIKYKPELIQPLEIAQLIQNLGFGATVIEDHAETEGNVELLITGMTCASCVHNIESKLMRTNGILYASVALATCKAHIQFDPEITGPRDIIKIIEEIGFHASVARRVPNAHNLDHKKEIQQWRKSFLCSLLFGIPVLILMIYMLIPNGEHHGSMVLEQNIIPGLSVLNLLFFVLCTFVQFLGGWYFYVQAYKSLKHKMANMDVLIVLATTIAYVYSCVILMVAIVEKAEKSPITFFDTPPMLFVFIALGRWLEHIAKSRTSEALAKLISLQATEATVVTLGPDHSIIREEQVAVELVQRGDIVKVVPGGKFPVDGKVIEGTSMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVNATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADQFSGYFVPFIIIISTVTLIVWITIGFINFDVIQKYFPNQNKHVSKAELILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITCGVPKVMRVLLLGDTAVLSLKKVLAVVGTAEASSEHPLGVAVTKYCREELGTQSLGYCTDFQAVPGCGISCKVGGVEAVLDMAEEGLDKLDANRSGDSSAPLGDNMLVMLSESHGPSVSHTYSVLIGNREWMRRNGLHIANDINDAMTDHETKGQTAILVAIDGMLCGMIAIADTVKQEAALAVHTLKNMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNGKVKVAMVGDGVNDSPALARADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLVLALIYNLLGIPIAAGVFMPIGLVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDTESYEAQAQGHMKPLTPSQISVHIGMDDRRRDSSRPAPWDQISQVSLSSLTADKLPKHNGFVEEEGDKWSLLINGRDEEQYI"
ORIGIN      
gtttgacagtagctcataccaggtattctctggaataacagaagttgcagaaacattaaaaggtcctaaccataggctttgtccaccactgattctccccctggctttgagctggagcctacaatgaaacacagttttgcttttgataacatgggctacgaggacagctttgaaactgggccctcttcatcttcccaagaacacactgtggcagtcaacattgtgggaatgacttgccaatcatgtgtgcagtcgatagaaggccgaatttccaaggtgaagggcattgtgagtattaaagtctcccttgaacagaacaatgctgtaataaagtatctgaagtcagacataagtgctgagcagatttgcaaagaaattcaggatatgggctttgatgcgaacatagcagaagagaggttgacaacagcggctgtaaatttgtcatgcttgaaagaagcagtagttaagcttcgggtagaaggcatgacatgccagtcttgtgccaccaacattgaaggaaagatgaggaagctgcatggtgtggcaaaagtcaaggtgtcacttggtaaccaggaagctattattgcgtactatccttacatcattcagcctgatgacctcaaaaatcatatcagtaacctggggtatgagtgcaccatcaaaagtaaatcagcccctttgaagctgggcgtccttgatcttgagcgcttgcagaatgcaaaccccaaagagacaccagcaagtcttgagagcaatggagtagatccgcggttcaccaagatgaatagcacagctacggtggttctacatgtagaaggcatgcactgcaactcctgtgtcagaaacatcgaaggaaatatatctgatcttcctggcatacaaagtattaaagtgtcattggagcataaaagtgctgtggtacagtatagctcaaacttaattaccctgtcagctttgcagcaagctattgaatcacttccacctggaaactttaaagtatgcctccttaatggttcagaaacaaataaagaagcatctccatcacctgcttcccaacaaaatcttttcagagagccactgcaagacatgacatgtacggctgttgttaggattgatggcatgacctgcagttcttgtgtacagtccatagaagggaccatatcacagagacaaggagtgcaacgtatagcagtttctttagctggcagaactgggaccatacattatgatccatctgtcactaacggagaagagttaaaagctgccatagaagacatggggtttgatgtttctatactgacagatactgccactggagaacataagcctgacaccagcaaagctgctgtgcagcctcaagctccagatcctcctctccgagactgttcctcggatgctgctcaagacagaccacatcgtgatgggccaaaccagcccagtggagcgatagctgggaagtgttttttacaaatcactggcatgacctgtgcatcctgtgtgtctaccattgagaggaatttgcagaaacaagatgggattgtttcagtgttggtagcactgatggcaggtaaagcagagataaaatacaagccagaactcatacagcctcttgaaatagcacagctgatccagaatttgggttttggtgctactgtcatagaagatcatgcagaaacagaagggaatgtggagcttctaattacagggatgacttgtgcttcttgtgttcacaatattgaatccaaactcatgagaacaaatggcatattatatgcctcagttgcacttgccacatgcaaagctcacatccagtttgatcctgagattactggacctcgagatattataaaaataattgaggaaattggctttcatgcttctgtggctagaagagttccaaatgcacataacctagatcataaaaaggaaatccaacagtggaggaaatctttcttgtgcagcctgctgtttggtatccctgtcttaatcctaatgatttatatgctaatacccaatggtgagcaccatgggtctatggtgctggaacagaacatcattcctggattatctgttttaaatcttctcttctttgtcctgtgcacttttgttcagtttcttggtgggtggtatttttacgtacaagcttacaaatcactgaagcacaagatggccaatatggatgtgctcatcgtactagccacgacgattgcctatgtgtattcctgtgttatcctcatggtagcaatagttgaaaaggcagagaaaagccccatcactttctttgacactcctccgatgctgtttgtattcattgcacttgggagatggctggaacacatagcaaagagtaggacctcagaagctcttgctaaacttatatctcttcaagccacagaagccactgtggtgactcttggacctgaccactctatcatcagggaggagcaggtagctgttgaactggttcaaaggggtgatattgtaaaggttgttcctggtggaaagttcccagtggatggaaaggtcattgaaggcacttctatggcagatgagtctctcattactggagaagctatgccagtcaccaaaaagcctgggagcacagtgattgctggttctataaatgcacatggctcagttcttgttaatgcaactcatgttggtaatgataccactctggcacagattgtgaaattagtggaagaagctcaaatgtcaaaggcacccatccagcaactggcagaccagtttagtggatattttgtaccgtttatcatcatcatttcaacagtgacattgatagtatggatcacaattgggtttataaattttgatgttattcaaaaatattttcctaatcagaacaaacacgtttcaaaagctgaactaatattgaggtttgcgtttcaaacctcaatcactgtgttgagcattgcatgcccatgttctttaggcttggctacccccacagctgtgatggtgggcacaggcgttgctgcacagaatggtatcctcatcaaaggtggaaaacccctggaaatggcacacaagatcaagactgtaatgtttgataaaactgggaccatcacctgtggagttcctaaagtcatgagggtgcttttgctgggagacacagctgtgctctctctgaagaaggtactggcagtggttggcactgcagaagccagcagcgaacatcctctaggagttgcagttactaaatattgcagagaggagcttggtactcagagcttgggatactgcaccgacttccaggcagtcccaggctgtggcatcagctgcaaggtcggaggtgttgaggctgtcctggatatggccgaggagggtctcgataagctggatgctaacaggagcggggacagcagtgctcctctgggagataatatgttggtcatgctctcagaatcacatggtccatcagtttctcacacatactcagtattgattggaaaccgtgaatggatgcgacgcaatggcttgcatattgcaaatgacataaatgatgcaatgacagatcatgaaacaaaaggacagactgccatactagtggctatagatggtatgctgtgtggaatgattgcaatagcagacactgtcaagcaggaggcagcacttgctgtgcacacgctgaaaaacatgggcatagatgtggtgctgataacgggggacaacaggaaaactgcaaaagccattgctactcaggttgggatcaaaaaagtctttgctgaggttcttccttctcacaaggttgcaaaggtccaggaactccaaaatgggaaggtgaaggttgcaatggttggtgatggagtcaatgattctcctgcgctagccagggccgatgttggaattgcaattggaacaggcactgacgttgcgattgaagcagccgatgttgttcttatccgaaatgacttgctggatgtagttgccagtattcacttatcgaagagaacagttcggagaatacgaataaatctggttctcgccttaatttataatttgcttggaatacccatagcagcaggtgtgttcatgcctattggccttgtgcttcagccttggatgggatcagctgccatggcagcttcttctgtgtctgtcgtgttgtcttctctgcagctgaaatgttataagaagccagacacagaaagttatgaagcacaagctcaaggccacatgaagccacttactccttcccaaatcagtgttcatattggaatggatgataggaggagggattcatccagaccagctccttgggatcagattagccaagtatctctctcttccttgacggcagacaagctgccgaaacataatgggtttgttgaggaagaaggggacaagtggtcattgctcattaatggaagagatgaagaacagtacatctgaagcactgtattcttagtacaggaggaaacattccttcccactagtgatggcaggaactgacttatttcaccaagagcttcaagacttcaaatgaagtaattccttcagctcataaaacaattgctactcagctcaatgttggcttgtggatttttttcaagtcaccagttatttcaagtcacagaaaggatctgtggctctataatgaactggctcctttgcacacagcaattagtgaaataatgtaaaattgtaattttcagggtctaaaagagtttctttcttctggactttgatgtttgccaggcaccaagtctcatactttgcattatttctaattttattatttcaagagcacctgaagcaaaaatatttagctgccaaataataatttctgtgtccaaatgaaaacagacatggcataaattgctctctggtaggaagctgtattttttcactgaatcctaactagtcatatcactgtgagagcactttgtctttaggatttatgtgcatctccttggaataaaaatgcttcagtgtttcactgactataactttctgaaaggtctctttcaaagattttcatgtgttttcaggtattgcatctgtttgatgcacacttgcatttctgaacttcctgttctgtcatttcctctgctctcctagattttctcttttgctccatgcaagctctttttttctcctgttgttgcacaaggtatcttctatgagttattactatgtttacagataatcctgtttgggacaaatttctttaagtcaccagaaacttttcctttctccacaaaagtccacaaaattcctgatccaaattagcgtatcattttcctgtggatattttgaaggaccccatgaagctcctgacaattgggcagttgtctgtctcttccctctgacagagtgaagaatttatcccactgtgagcaaaggtggtatttaccatggtgtaactcagagcagaactatgctggagcatagaatcatagaatagttaggattggaaaggaccttaaaatcatctagttccaacccccctgccatgggcagggacacctcccactaaaccatgtcacccaagcatggttgaaaggagtatgtttattgcataagttgaccccatctttcttaaaagggagacacatgtttaaatgctaatggtggaaaaatggccttaaaatgtgggatttctagttgctatcatataaataaccttttctgatgacagaaggttttaaactaagaggatttgtaatagcttgaattttaatataaatttgtattcatgttttgaatttgttttaatttccctatttactctagtttaataagaaatcaaggtactgaacagccctgttttcagtttagcatatttaccaaagcttgcagtaactatcactgtgaatgtcaaattcatcccttaacactttttagagttaggacagtaggaatcaagggctttggtgcactgaatgtgtgcagtcccagggtgctgctttgcttagctgtgggactctgaattaagcagaccagagttttatagtttaatctaaaaaaatgaaaatagaggaattactatgctaaacaatgtgaaataaacacttattttcattgacttaaagatagagctgtttccagcatgggttcaaatcatgctcttcctaatgtaagaatgaaaaacaagtcggagaggaaaagaactgtgcttggagcatttggcaggtcttcctattttctcttcctcatggtatatttgaggtctccttagaaaacttcagcagcactgtttaaatataattacgaatcagttttaaaattgtaaaatctctttatatgtgtagagattactttcacagcacacacacttttcaaataatgccataggtgcctatacatgtccctatggggaagatggtctactgttttactgttgtatgtctttttaccagtgctcacagtaaaaatactgttattttttactaaaacaaacaaacaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]