GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-07-11 16:09:50, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       XM_031035770            7286 bp    mRNA    linear   MAM 30-SEP-2019
DEFINITION  PREDICTED: Leptonychotes weddellii ATPase copper transporting beta
            (ATP7B), transcript variant X1, mRNA.
ACCESSION   XM_031035770
VERSION     XM_031035770.1
DBLINK      BioProject: PRJNA232772
KEYWORDS    RefSeq.
SOURCE      Leptonychotes weddellii (Weddell seal)
  ORGANISM  Leptonychotes weddellii
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Carnivora; Caniformia;
            Pinnipedia; Phocidae; Leptonychotes.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_006384224.1) annotated using gene prediction method: Gnomon,
            supported by mRNA evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Leptonychotes weddellii Annotation
                                           Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..7286
                     /organism="Leptonychotes weddellii"
                     /mol_type="mRNA"
                     /isolate="WS11-02"
                     /db_xref="taxon:9713"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="liver"
     gene            1..7286
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 9 mRNAs, 4 Proteins, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 2 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:102730267"
     CDS             577..5208
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X1"
                     /protein_id="XP_030891630.1"
                     /db_xref="GeneID:102730267"
                     /translation="
MTRWRGEGELLARMVGKGVTVDTAMEEAGGEMPRSPEPSFLATLGDPQVTLVSVHKRWSFRRNAGARGSTRPVTSEEEGEFSQKVLNGTRGIRSNQILSKVSLPARAGEPAMKQSFAFDNVGYEGGLDGVCPPQMTSSTISISGMTCQSCVKSIEGRISSLKGIVSIKVSLEQGSATVKYVPSILSLPQICRHIEDMGFEASIAEGKAASWPSRSSPGLEAVVKLRVEGMTCQSCVSSIEGRLGKLQGVVRVRVSLGTQEAVITYQPYLIQPQDLRDHVNDMGFEAVIKNRVAPVSLGPIDIGRLQRTDPKTPSASDNQNLNNSEPSGHHGSHVVTLQLRVDGMHCKSCVLNIEENIGPLPGVQNIQVSLENRIAQVQYDPSRITADALQRAIEALPPGDFKVSLPDGAAGGGAGSRSSDRAAPAPAPRTQEPGVCSTVVLAIAGMTCASCVQSIEGLVSQREGVQQISVSLADGTGVVLYDPSVIHPEELRAAVEEMGFETSVLFENCYSNHVGNHSAGNSSAHPTAGVPVSVQEEAPHAGGLPKNHSPGSSSKSPQASTTAAPQKCFLQITGMTCASCVSNIERNLQKEAGILSVLVALMAGKAEVKYNPEVIQPLEIARLIRDLGFEAAVMEDYTGSDGDLELIITGMTCASCVHNIESKLTRTNGITYASVALATSKAHVKFDPEIIGARDIVRIIEEIGFHASPAQRNPNAHHLDHKVEIKQWKKSFLCSLVFGIPVMGLMLYMLVPSSEPHESMVLDHNIIPGLSILNLIFFILCTFVQLLGGWYFYVQAYRSLRHRAANMDVLIVLATGIAYTYSLVILVVAVAEKAERSPVTFFDTPPMLFVFIALGRWLEHVAKSKTSEALAKLMSLQATEATVVTLGEDNLIIREEQVPMELVQRGDIIKVVPGGKFPVDGKVLEGNTMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVNATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADRFSGYFVPFIIIISTLTLVVWIIIGFIDFGVVQKYFPTPNKHISQAEVIIRFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITHGVPKVMRVLLLVDVAMMPLRKVLAVVGTAEASSEHPLGMAVTKYCKEELGTETLGYCTDFQAVPGCGIGCKVSSVEGILAHGERQQSKQAAPLSRTGSVPEAIDATPQTFSVLIGNREWMRRNGLTISSDISDAMTDHEMKGQTAILVAIDGVLCAMIAIADAVKQEAALAVHTLKSMGVDVVLITGDNRRTARAIATQVGINKVFAEVLPSHKVAKVQELQNEGKKVAMVGDGVNDSPALARADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVWRIRLNLVLALIYNLIGIPIAAGVFMPIGIVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDLERYEAQAQGRMKPLTASQVSVHIGMDDRRRDSPRATPWDQVSFISQVSLSSLKSDKLSRHSAAADDGGDKWSLLLNDRDEEQCI"
     misc_feature    991..1182
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1009..1017,1024..1026)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1246..1434
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1264..1272,1279..1281)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1588..1764
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1606..1614,1621..1623)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1888..2079
                     /gene="ATP7B"
                     /note="Copper chaperone CopZ [Inorganic ion transport and
                     metabolism]; Region: CopZ; COG2608"
                     /db_xref="CDD:442020"
     misc_feature    2284..2472
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(2299..2307,2314..2316)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2509..2700
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(2527..2535,2542..2544)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2764..4872
                     /gene="ATP7B"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(3757..3759,3763..3765,4801..4803)
                     /gene="ATP7B"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(3889..3897,4099..4101,4252..4260,4348..4350,
                     4468..4476,4534..4536,4543..4545,4552..4554,4609..4611,
                     4618..4620)
                     /gene="ATP7B"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      
acaaagctgcaggaaacatggaactctcttacaccttcttgaaaatgcaagtcatgttgcctaggaaatacttctgtcccctagtgtgctgcacacgccagcactgcagccacggaagagacagccggagttattccaagaaagctctggaagtttgacaataagcggaagtgtcatttctgccctccgtcaaggctggggttctgggagtgcacatggccgagaggaaaccgtgctcagctttgggaggtgattccgtgccgggctcctgcacacgctggctggtgtcctggccgggctgggtgagggcacgcatggggccgtgtgcagagactcccagtgcctgatgcggtgtgatgagtgagagggtgccagttggctggaaggatgtaggtaaacaagagcaaatatctacagcggtgcgcagcctgcccgagctccgaagctggctgctggacttggctggcagcctctcagcggactggctccggagcagaggggaatccgcaggacggatcacagaaggtgcctccccctgctagttaggaggacacttttaaagcatttccttctcacatgaccaggtggcgtggtgagggtgaactgcttgctcgaatggtgggtaaaggtgtgaccgtggacacagcgatggaggaagctgggggtgagatgcccaggagccctgagccgtccttcctggcgaccctgggtgacccacaggtcaccctggtgtccgtccacaagcggtggtccttcaggaggaacgctggggccaggggctccaccaggccagtgacttcggaggaggaaggagagttttcccagaaggttttgaatggaacacggggaatccgttccaatcagatcctgtctaaagtttctctgcccgctcgtgccggggagccagcaatgaagcagagtttcgcctttgacaatgttggctatgaaggcggcctggatggcgtgtgcccccctcagatgaccagcagcaccatcagcatttcgggcatgacttgccagtcgtgtgtaaagtctatcgagggcaggatttccagcttgaaaggcatcgtgagcattaaggtttccctggaacaaggcagcgcgaccgtgaagtacgtgccgtccatcctgagcctgccgcagatttgccggcacattgaggacatgggctttgaggccagcatcgcagaaggaaaggccgcctcctggccttcaaggtcctcgcctggcctggaggccgtggtcaagctccgggtggagggcatgacctgccagtcctgcgtcagctccattgaaggcaggcttgggaaactgcaaggggtagtgagggtccgagtgtccctcggcacccaggaagcagtcattacctaccagccttatctcatccagccccaggacctcagggaccatgtcaacgacatgggctttgaagctgtcatcaagaacagagtagcgcccgtaagcctgggacccattgatattgggcggttacagaggaccgacccaaagacaccttcggcttctgataaccagaatctcaataactctgagccctcgggacaccacgggagccacgtggtcaccctgcaactgagagtagatggaatgcactgtaagtcttgtgtcctgaatattgaagaaaacataggcccactccctggggttcaaaatattcaagtgtccttggagaacagaatcgcccaagtacagtacgacccttctcgtatcactgcagacgccctgcagagggccattgaagctcttccgcctggggactttaaagtctctcttcctgatggagcagcagggggtggggcaggtagcaggtcttccgaccgggcggcccccgcccccgccccgagaacccaggagccaggcgtgtgcagtaccgtggtgcttgccatcgctggaatgacctgtgcgtcctgtgtccagtccatcgaaggcctggtctcccagagggaaggggtgcagcaaatatcagtctctctggctgacgggaccggagtggtgctctatgatccctctgtaattcacccggaagaactccgagctgctgttgaagaaatgggatttgagacttcagtcctttttgaaaactgttacagcaaccatgttggaaaccacagtgcggggaattcctcagcgcaccccacagctggcgtacctgtgtctgtgcaggaagaggctccccatgctgggggccttcctaaaaaccacagccctggctcctcgtccaagtccccgcaagcctctaccacagcagcacctcagaagtgctttttacagatcacaggcatgacctgtgcatcctgtgtgtccaacatagagagaaacctgcagaaagaagcaggtattctctcggtgctggttgccctgatggccgggaaggcagaggttaagtataacccagaagtcatccagccgctggagatagctcggctcatccgggacttgggctttgaggcggcggtaatggaagactacacaggctcagatggcgacctcgagctgatcatcacggggatgacctgcgcatcctgtgttcacaacatagagtccaaactcacaaggacaaacggcatcacctacgcgtctgtggcccttgccaccagcaaagcccacgtgaagttcgatcctgaaattatcggtgcacgggatattgtccgaattatcgaggaaatcggctttcatgcttccccggcccagagaaaccccaacgcgcatcacttggaccacaaggtggaaataaagcagtggaagaagtcttttctgtgcagcctggtgttcggcatccccgtcatgggtctgatgctctatatgttggtgcccagcagcgagccccacgagtctatggtgctggaccacaacatcattccaggactgtccattctaaatctcatcttctttatcttgtgtacctttgtccagctccttggcgggtggtacttctacgtccaggcctacagatctctgaggcacagggcggccaacatggatgtgctcattgtgctggccaccggcatcgcctacacctactcgctcgtcatcctggtggtggctgtggccgagaaggcggagaggagccccgtgaccttcttcgacaccccccccatgctctttgtgttcattgccctggggcggtggctggaacacgtggcaaagagcaaaacctcagaagcccttgccaaactcatgtctctccaagccacagaagccactgttgtgacccttggcgaggacaacttgatcatcagagaggagcaggtacccatggagctggtgcagcggggtgatatcatcaaagttgtccccgggggaaagttcccagtggatgggaaagtcctggaaggcaacaccatggccgacgagtccctcatcacaggagaagccatgcccgtcacgaagaaacctggaagcacagtgattgctgggtctataaatgcacacggctctgtgctcgttaatgccacccatgtgggcaatgacaccacgttggctcagattgtgaaattggtggaagaggctcagatgtcaaaggcacccattcagcaactggctgaccggtttagtggatattttgtcccatttatcatcatcatttcaacgttgacgttggtggtatggattataatcggttttatcgattttggtgttgttcagaaatactttcctacccccaacaagcatatctcccaggcagaggtgatcatccggtttgcgttccagacatccatcacggtgctgtgcattgcctgcccctgctccctgggcttggccacgcccacggcagtcatggtgggcaccggggtggccgcccagaatggcatcctcatcaaaggaggcaagcctctggagatggcccacaagataaagaccgtgatgtttgacaaaactggcaccattacccatggggtccccaaagtcatgagggtcctcctgcttgtggatgtggccatgatgcccctcaggaaggttcttgctgtggtggggactgcggaggccagcagcgagcaccctttgggcatggcagtcaccaagtactgtaaagaggaattgggaaccgagaccttgggatactgcacggacttccaggcagtgccgggctgtggcatcggctgcaaagtcagtagcgtggagggcatcctggcccacggcgagcgccagcagagcaaacaggctgctcccctgagcaggactggcagcgttcccgaggcgatagatgcgaccccccagaccttctctgtgctgattgggaaccgcgaatggatgaggcgcaacggcctaaccatttccagcgacatcagtgacgcgatgacagatcatgagatgaaaggccagacggccatcctggtggccattgacggcgtgctctgcgccatgatcgccatcgcggatgcagtcaagcaggaggcagccctggccgtgcacacgctgaagagcatgggtgtggacgtggttctgatcacaggggacaaccggaggacagccagagccatcgccacccaggttggcatcaacaaggtctttgcagaggtcctgccttctcacaaggtggccaaggtccaggagctccagaatgaagggaagaaggtcgccatggtgggagatggggtcaatgactcaccagccttggcccgggctgatgtgggcattgccatcgggacaggcacggacgtcgccattgaggctgctgacgttgtcctcatcagaaacgatttgctcgatgtggtggctagcattcacctgtccaagaggaccgtctggagaatacgcctcaatctggtgctggcgttgatttataacctgatcggaatacccattgccgcaggggtcttcatgcccatcggcatcgtgctacagccgtggatgggctcggcggccatggcggcctcctccgtgtctgtggttctctcatcgctgcagctcaagtgctataagaagcccgacctggagaggtatgaggcgcaggcccagggccgcatgaagcccctgacggcgtcgcaggtgagcgtgcacatcggcatggatgaccggcgacgggactccccgagggccacgccctgggaccaggtcagcttcatcagccaggtgtctctgtcctccctgaagtccgacaagctgtctcgacacagtgctgcggctgatgatggtggggacaagtggtctctgctcctgaatgacagagatgaggagcagtgcatctgaaagctccaggcgggtgcagagccaggggtccgtctcctcagtgagtagccggcccggctttccccgtggccgaggctcaggccaaacaggtgcagcactagcagcaggatgggcgaagctcccctccagccatggggacttcgactccctggacattcctggtcatccctcctagcatgtgccacgtccagatgtggctcctgggtaggccccgcccccaccccacccccaccccctgtgcctggatcccaccagcacaggggccaggcttcccgggctgaccatgctgttggcctgggcttgtcgggaaccttgctggactctagcagaggagaggacagccagccctcctcgcagacctctgctttagtgtttggaatgactgcttataaaatgaggaaaatctcaccaggaccaaaaacttagctgggcctttccttagaactcacgagaagccttgtgttgggttctttttgacaacacccacatgcgttgcgtatctgagaccacagtttacctcaaatacaccccactgacgtctgccggcatcgtctcttccttttctgttcttaacactggggccagcccaccccagcccacccctgccagatctcttgacagcaggaccctagtgatccctgctgttgccctcaggcccgcatctgctccctctcgcgccggccagagagcccaccttgcttctcttcaggctgaggagagttctctcctgactgtgtgccccctggccacggagtcctggcttctcgctcctcggaatggtgtgctcttgtggattgttgccgccccgctggagtgagggtctcagagcctgagacctgggaaatcctgcctcctgtggggtccaggtccttgggacatgcggaggcctgtcgtgcttgaaaccgcgtcccgtggggaggtgtgtgcgcttgccagaccgccttgcacacctccaggagcttcagtgacatggtctgctatgggactgtcagctcgcggagttcagtagagttcacgtccgtggtgctcctgctggtgtccaactgcacggaaacgcgtacccgaagaagagggaatcacactctccagcagcttctgcttgtgcacacggggccggcgccttaggaaaggagtgaccactgctgccccaagggagagcgtgtttcacactttcagtggctctttgtgattgtaggaagtcagaggggcaggaatggggccggttttagacagtcaagtcggcggtgattggcggaaccacatggtagtacacgagtagaaagaaaataaattttaaggtagagagagcccttatcacacacaaaatagttttatttattgagtaccagttatgtttcagggacagtgtaagcactttttctaggctacttgtaatcttcccaacaaaccagccaagtagatactgctgtccacgttggacgggcagggcggtaggctcagagaggctgggtatcccgcccaggatcgcacagcccgcacacatgccaaaatagggaagtcttttctccgcggtggctgccaccagaatatcagttggcaggaataaacaggaaaaagccacctgctcctagaagaacaagtctgccaggtgatcgattcattgttagcgacttggaatgaaacttgatctcgggatcagctcacctttccctgggatggtttgtttccatttttgcctataatctcgtgttgctgggtcttaccccctacaatcctgcagtgggttccattgtgttcctgtcgttttcagtcttcctttccctcgggcctcttcctgccctgtccttcctttattcctggctgtgctcaggagggtttcttgttttctaactaggttaatcattgtctaaaggatctaattgtattgatttcacaaaggctttttaggaccataaacctcatgtgtatatggccgtgaaaatatttatataattgtacagaatataacctttagatgttcagggggtaagaattttttgtgtgtcagataagaagagttcctgtttcaaaaactttccatgctgtattagaataaagtttatttttattcatctaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]