2025-07-19 08:42:03, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS XM_031035770 7286 bp mRNA linear MAM 30-SEP-2019 DEFINITION PREDICTED: Leptonychotes weddellii ATPase copper transporting beta (ATP7B), transcript variant X1, mRNA. ACCESSION XM_031035770 VERSION XM_031035770.1 DBLINK BioProject: PRJNA232772 KEYWORDS RefSeq. SOURCE Leptonychotes weddellii (Weddell seal) ORGANISM Leptonychotes weddellii Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Carnivora; Caniformia; Pinnipedia; Phocidae; Leptonychotes. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_006384224.1) annotated using gene prediction method: Gnomon, supported by mRNA evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Leptonychotes weddellii Annotation Release 101 Annotation Version :: 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..7286 /organism="Leptonychotes weddellii" /mol_type="mRNA" /isolate="WS11-02" /db_xref="taxon:9713" /chromosome="Unknown" /sex="female" /tissue_type="liver" gene 1..7286 /gene="ATP7B" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 9 mRNAs, 4 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 2 samples with support for all annotated introns" /db_xref="GeneID:102730267" CDS 577..5208 /gene="ATP7B" /codon_start=1 /product="copper-transporting ATPase 2 isoform X1" /protein_id="XP_030891630.1" /db_xref="GeneID:102730267" /translation="
MTRWRGEGELLARMVGKGVTVDTAMEEAGGEMPRSPEPSFLATLGDPQVTLVSVHKRWSFRRNAGARGSTRPVTSEEEGEFSQKVLNGTRGIRSNQILSKVSLPARAGEPAMKQSFAFDNVGYEGGLDGVCPPQMTSSTISISGMTCQSCVKSIEGRISSLKGIVSIKVSLEQGSATVKYVPSILSLPQICRHIEDMGFEASIAEGKAASWPSRSSPGLEAVVKLRVEGMTCQSCVSSIEGRLGKLQGVVRVRVSLGTQEAVITYQPYLIQPQDLRDHVNDMGFEAVIKNRVAPVSLGPIDIGRLQRTDPKTPSASDNQNLNNSEPSGHHGSHVVTLQLRVDGMHCKSCVLNIEENIGPLPGVQNIQVSLENRIAQVQYDPSRITADALQRAIEALPPGDFKVSLPDGAAGGGAGSRSSDRAAPAPAPRTQEPGVCSTVVLAIAGMTCASCVQSIEGLVSQREGVQQISVSLADGTGVVLYDPSVIHPEELRAAVEEMGFETSVLFENCYSNHVGNHSAGNSSAHPTAGVPVSVQEEAPHAGGLPKNHSPGSSSKSPQASTTAAPQKCFLQITGMTCASCVSNIERNLQKEAGILSVLVALMAGKAEVKYNPEVIQPLEIARLIRDLGFEAAVMEDYTGSDGDLELIITGMTCASCVHNIESKLTRTNGITYASVALATSKAHVKFDPEIIGARDIVRIIEEIGFHASPAQRNPNAHHLDHKVEIKQWKKSFLCSLVFGIPVMGLMLYMLVPSSEPHESMVLDHNIIPGLSILNLIFFILCTFVQLLGGWYFYVQAYRSLRHRAANMDVLIVLATGIAYTYSLVILVVAVAEKAERSPVTFFDTPPMLFVFIALGRWLEHVAKSKTSEALAKLMSLQATEATVVTLGEDNLIIREEQVPMELVQRGDIIKVVPGGKFPVDGKVLEGNTMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVNATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADRFSGYFVPFIIIISTLTLVVWIIIGFIDFGVVQKYFPTPNKHISQAEVIIRFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITHGVPKVMRVLLLVDVAMMPLRKVLAVVGTAEASSEHPLGMAVTKYCKEELGTETLGYCTDFQAVPGCGIGCKVSSVEGILAHGERQQSKQAAPLSRTGSVPEAIDATPQTFSVLIGNREWMRRNGLTISSDISDAMTDHEMKGQTAILVAIDGVLCAMIAIADAVKQEAALAVHTLKSMGVDVVLITGDNRRTARAIATQVGINKVFAEVLPSHKVAKVQELQNEGKKVAMVGDGVNDSPALARADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVWRIRLNLVLALIYNLIGIPIAAGVFMPIGIVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDLERYEAQAQGRMKPLTASQVSVHIGMDDRRRDSPRATPWDQVSFISQVSLSSLKSDKLSRHSAAADDGGDKWSLLLNDRDEEQCI"
misc_feature 991..1182 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1009..1017,1024..1026) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1246..1434 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1264..1272,1279..1281) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1588..1764 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1606..1614,1621..1623) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1888..2079 /gene="ATP7B" /note="Copper chaperone CopZ [Inorganic ion transport and metabolism]; Region: CopZ; COG2608" /db_xref="CDD:442020" misc_feature 2284..2472 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(2299..2307,2314..2316) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 2509..2700 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(2527..2535,2542..2544) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 2764..4872 /gene="ATP7B" /note="P-type heavy metal-transporting ATPase, similar to human copper-transporting ATPases, ATP7A and ATP7B; Region: P-type_ATPase_Cu-like; cd02094" /db_xref="CDD:319783" misc_feature order(3757..3759,3763..3765,4801..4803) /gene="ATP7B" /note="putative Cu binding site [ion binding]; other site" /db_xref="CDD:319783" misc_feature order(3889..3897,4099..4101,4252..4260,4348..4350, 4468..4476,4534..4536,4543..4545,4552..4554,4609..4611, 4618..4620) /gene="ATP7B" /note="putative ATP binding site [chemical binding]; other site" /db_xref="CDD:319783" ORIGIN
acaaagctgcaggaaacatggaactctcttacaccttcttgaaaatgcaagtcatgttgcctaggaaatacttctgtcccctagtgtgctgcacacgccagcactgcagccacggaagagacagccggagttattccaagaaagctctggaagtttgacaataagcggaagtgtcatttctgccctccgtcaaggctggggttctgggagtgcacatggccgagaggaaaccgtgctcagctttgggaggtgattccgtgccgggctcctgcacacgctggctggtgtcctggccgggctgggtgagggcacgcatggggccgtgtgcagagactcccagtgcctgatgcggtgtgatgagtgagagggtgccagttggctggaaggatgtaggtaaacaagagcaaatatctacagcggtgcgcagcctgcccgagctccgaagctggctgctggacttggctggcagcctctcagcggactggctccggagcagaggggaatccgcaggacggatcacagaaggtgcctccccctgctagttaggaggacacttttaaagcatttccttctcacatgaccaggtggcgtggtgagggtgaactgcttgctcgaatggtgggtaaaggtgtgaccgtggacacagcgatggaggaagctgggggtgagatgcccaggagccctgagccgtccttcctggcgaccctgggtgacccacaggtcaccctggtgtccgtccacaagcggtggtccttcaggaggaacgctggggccaggggctccaccaggccagtgacttcggaggaggaaggagagttttcccagaaggttttgaatggaacacggggaatccgttccaatcagatcctgtctaaagtttctctgcccgctcgtgccggggagccagcaatgaagcagagtttcgcctttgacaatgttggctatgaaggcggcctggatggcgtgtgcccccctcagatgaccagcagcaccatcagcatttcgggcatgacttgccagtcgtgtgtaaagtctatcgagggcaggatttccagcttgaaaggcatcgtgagcattaaggtttccctggaacaaggcagcgcgaccgtgaagtacgtgccgtccatcctgagcctgccgcagatttgccggcacattgaggacatgggctttgaggccagcatcgcagaaggaaaggccgcctcctggccttcaaggtcctcgcctggcctggaggccgtggtcaagctccgggtggagggcatgacctgccagtcctgcgtcagctccattgaaggcaggcttgggaaactgcaaggggtagtgagggtccgagtgtccctcggcacccaggaagcagtcattacctaccagccttatctcatccagccccaggacctcagggaccatgtcaacgacatgggctttgaagctgtcatcaagaacagagtagcgcccgtaagcctgggacccattgatattgggcggttacagaggaccgacccaaagacaccttcggcttctgataaccagaatctcaataactctgagccctcgggacaccacgggagccacgtggtcaccctgcaactgagagtagatggaatgcactgtaagtcttgtgtcctgaatattgaagaaaacataggcccactccctggggttcaaaatattcaagtgtccttggagaacagaatcgcccaagtacagtacgacccttctcgtatcactgcagacgccctgcagagggccattgaagctcttccgcctggggactttaaagtctctcttcctgatggagcagcagggggtggggcaggtagcaggtcttccgaccgggcggcccccgcccccgccccgagaacccaggagccaggcgtgtgcagtaccgtggtgcttgccatcgctggaatgacctgtgcgtcctgtgtccagtccatcgaaggcctggtctcccagagggaaggggtgcagcaaatatcagtctctctggctgacgggaccggagtggtgctctatgatccctctgtaattcacccggaagaactccgagctgctgttgaagaaatgggatttgagacttcagtcctttttgaaaactgttacagcaaccatgttggaaaccacagtgcggggaattcctcagcgcaccccacagctggcgtacctgtgtctgtgcaggaagaggctccccatgctgggggccttcctaaaaaccacagccctggctcctcgtccaagtccccgcaagcctctaccacagcagcacctcagaagtgctttttacagatcacaggcatgacctgtgcatcctgtgtgtccaacatagagagaaacctgcagaaagaagcaggtattctctcggtgctggttgccctgatggccgggaaggcagaggttaagtataacccagaagtcatccagccgctggagatagctcggctcatccgggacttgggctttgaggcggcggtaatggaagactacacaggctcagatggcgacctcgagctgatcatcacggggatgacctgcgcatcctgtgttcacaacatagagtccaaactcacaaggacaaacggcatcacctacgcgtctgtggcccttgccaccagcaaagcccacgtgaagttcgatcctgaaattatcggtgcacgggatattgtccgaattatcgaggaaatcggctttcatgcttccccggcccagagaaaccccaacgcgcatcacttggaccacaaggtggaaataaagcagtggaagaagtcttttctgtgcagcctggtgttcggcatccccgtcatgggtctgatgctctatatgttggtgcccagcagcgagccccacgagtctatggtgctggaccacaacatcattccaggactgtccattctaaatctcatcttctttatcttgtgtacctttgtccagctccttggcgggtggtacttctacgtccaggcctacagatctctgaggcacagggcggccaacatggatgtgctcattgtgctggccaccggcatcgcctacacctactcgctcgtcatcctggtggtggctgtggccgagaaggcggagaggagccccgtgaccttcttcgacaccccccccatgctctttgtgttcattgccctggggcggtggctggaacacgtggcaaagagcaaaacctcagaagcccttgccaaactcatgtctctccaagccacagaagccactgttgtgacccttggcgaggacaacttgatcatcagagaggagcaggtacccatggagctggtgcagcggggtgatatcatcaaagttgtccccgggggaaagttcccagtggatgggaaagtcctggaaggcaacaccatggccgacgagtccctcatcacaggagaagccatgcccgtcacgaagaaacctggaagcacagtgattgctgggtctataaatgcacacggctctgtgctcgttaatgccacccatgtgggcaatgacaccacgttggctcagattgtgaaattggtggaagaggctcagatgtcaaaggcacccattcagcaactggctgaccggtttagtggatattttgtcccatttatcatcatcatttcaacgttgacgttggtggtatggattataatcggttttatcgattttggtgttgttcagaaatactttcctacccccaacaagcatatctcccaggcagaggtgatcatccggtttgcgttccagacatccatcacggtgctgtgcattgcctgcccctgctccctgggcttggccacgcccacggcagtcatggtgggcaccggggtggccgcccagaatggcatcctcatcaaaggaggcaagcctctggagatggcccacaagataaagaccgtgatgtttgacaaaactggcaccattacccatggggtccccaaagtcatgagggtcctcctgcttgtggatgtggccatgatgcccctcaggaaggttcttgctgtggtggggactgcggaggccagcagcgagcaccctttgggcatggcagtcaccaagtactgtaaagaggaattgggaaccgagaccttgggatactgcacggacttccaggcagtgccgggctgtggcatcggctgcaaagtcagtagcgtggagggcatcctggcccacggcgagcgccagcagagcaaacaggctgctcccctgagcaggactggcagcgttcccgaggcgatagatgcgaccccccagaccttctctgtgctgattgggaaccgcgaatggatgaggcgcaacggcctaaccatttccagcgacatcagtgacgcgatgacagatcatgagatgaaaggccagacggccatcctggtggccattgacggcgtgctctgcgccatgatcgccatcgcggatgcagtcaagcaggaggcagccctggccgtgcacacgctgaagagcatgggtgtggacgtggttctgatcacaggggacaaccggaggacagccagagccatcgccacccaggttggcatcaacaaggtctttgcagaggtcctgccttctcacaaggtggccaaggtccaggagctccagaatgaagggaagaaggtcgccatggtgggagatggggtcaatgactcaccagccttggcccgggctgatgtgggcattgccatcgggacaggcacggacgtcgccattgaggctgctgacgttgtcctcatcagaaacgatttgctcgatgtggtggctagcattcacctgtccaagaggaccgtctggagaatacgcctcaatctggtgctggcgttgatttataacctgatcggaatacccattgccgcaggggtcttcatgcccatcggcatcgtgctacagccgtggatgggctcggcggccatggcggcctcctccgtgtctgtggttctctcatcgctgcagctcaagtgctataagaagcccgacctggagaggtatgaggcgcaggcccagggccgcatgaagcccctgacggcgtcgcaggtgagcgtgcacatcggcatggatgaccggcgacgggactccccgagggccacgccctgggaccaggtcagcttcatcagccaggtgtctctgtcctccctgaagtccgacaagctgtctcgacacagtgctgcggctgatgatggtggggacaagtggtctctgctcctgaatgacagagatgaggagcagtgcatctgaaagctccaggcgggtgcagagccaggggtccgtctcctcagtgagtagccggcccggctttccccgtggccgaggctcaggccaaacaggtgcagcactagcagcaggatgggcgaagctcccctccagccatggggacttcgactccctggacattcctggtcatccctcctagcatgtgccacgtccagatgtggctcctgggtaggccccgcccccaccccacccccaccccctgtgcctggatcccaccagcacaggggccaggcttcccgggctgaccatgctgttggcctgggcttgtcgggaaccttgctggactctagcagaggagaggacagccagccctcctcgcagacctctgctttagtgtttggaatgactgcttataaaatgaggaaaatctcaccaggaccaaaaacttagctgggcctttccttagaactcacgagaagccttgtgttgggttctttttgacaacacccacatgcgttgcgtatctgagaccacagtttacctcaaatacaccccactgacgtctgccggcatcgtctcttccttttctgttcttaacactggggccagcccaccccagcccacccctgccagatctcttgacagcaggaccctagtgatccctgctgttgccctcaggcccgcatctgctccctctcgcgccggccagagagcccaccttgcttctcttcaggctgaggagagttctctcctgactgtgtgccccctggccacggagtcctggcttctcgctcctcggaatggtgtgctcttgtggattgttgccgccccgctggagtgagggtctcagagcctgagacctgggaaatcctgcctcctgtggggtccaggtccttgggacatgcggaggcctgtcgtgcttgaaaccgcgtcccgtggggaggtgtgtgcgcttgccagaccgccttgcacacctccaggagcttcagtgacatggtctgctatgggactgtcagctcgcggagttcagtagagttcacgtccgtggtgctcctgctggtgtccaactgcacggaaacgcgtacccgaagaagagggaatcacactctccagcagcttctgcttgtgcacacggggccggcgccttaggaaaggagtgaccactgctgccccaagggagagcgtgtttcacactttcagtggctctttgtgattgtaggaagtcagaggggcaggaatggggccggttttagacagtcaagtcggcggtgattggcggaaccacatggtagtacacgagtagaaagaaaataaattttaaggtagagagagcccttatcacacacaaaatagttttatttattgagtaccagttatgtttcagggacagtgtaagcactttttctaggctacttgtaatcttcccaacaaaccagccaagtagatactgctgtccacgttggacgggcagggcggtaggctcagagaggctgggtatcccgcccaggatcgcacagcccgcacacatgccaaaatagggaagtcttttctccgcggtggctgccaccagaatatcagttggcaggaataaacaggaaaaagccacctgctcctagaagaacaagtctgccaggtgatcgattcattgttagcgacttggaatgaaacttgatctcgggatcagctcacctttccctgggatggtttgtttccatttttgcctataatctcgtgttgctgggtcttaccccctacaatcctgcagtgggttccattgtgttcctgtcgttttcagtcttcctttccctcgggcctcttcctgccctgtccttcctttattcctggctgtgctcaggagggtttcttgttttctaactaggttaatcattgtctaaaggatctaattgtattgatttcacaaaggctttttaggaccataaacctcatgtgtatatggccgtgaaaatatttatataattgtacagaatataacctttagatgttcagggggtaagaattttttgtgtgtcagataagaagagttcctgtttcaaaaactttccatgctgtattagaataaagtttatttttattcatctaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]