2024-04-25 01:22:52, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_030949573 4410 bp mRNA linear VRT 26-SEP-2019 DEFINITION PREDICTED: Camarhynchus parvulus ATPase copper transporting beta (ATP7B), transcript variant X2, mRNA. ACCESSION XM_030949573 VERSION XM_030949573.1 DBLINK BioProject: PRJNA566393 KEYWORDS RefSeq. SOURCE Camarhynchus parvulus ORGANISM Camarhynchus parvulus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Passeriformes; Thraupidae; Camarhynchus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_044571.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Camarhynchus parvulus Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..4410 /organism="Camarhynchus parvulus" /mol_type="mRNA" /db_xref="taxon:87175" /chromosome="1" gene 1..4410 /gene="ATP7B" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 8 Proteins, and 78% coverage of the annotated genomic feature by RNAseq alignments" /db_xref="GeneID:115904287" CDS 16..4410 /gene="ATP7B" /codon_start=1 /product="copper-transporting ATPase 2 isoform X2" /protein_id="XP_030805433.1" /db_xref="GeneID:115904287" /translation="
MPGTVFSRRNLRSFIYRALSNIDSPPGCELKPTMKHNFAFDNMGYEASSETMPSPPSQEHIVVLNIVGMTCQSCVQSIEGRISKVKGILRIKVSLEQNNAVIKYRQSEISPEQICQEILDMGFDANIAEEKLTTATVNFPSLKEAVAKLRVEGMTCQSCVTNIEGKIRKLHGVAKIKVSLDNQEAIIVYHPYIIQPDDLKRHISDLGYDCTIKSKSAPLKLGALDLQRLQNANPRETPASLDSDGLDLLVPKMGSTATVTVQIEGMHCKSCVRNIEGNISDLPGIKSIKVSLEHKCAVVQYSPDLITLSAFQQAIESLPPGNFKVSLLSGSEANKAASSSGAFTYNVVRQPPQGMTHVAVIKIDGMTCHSCVQSIEGAVSQRQGVQNVAVSLAGSTGTIHYDPAVTSGEELRAAIEDMGFDASVLTDTAPGEHRCQPDGSKAAVQSQASEPPHHGNSPDALLDSPHPDGSNQLSGAIEEKCVLQITGMTCASCVSTIERNLQKEDGIVSVLVALMAGKAEIKYKPELIQPLEIAQLIQNLGFEATIMENNAETEGQVELLITGMTCASCVHNIESKLMRTNGIFSASVALATSKAHIQFDPEIIGPRDIIKVIKEIGFHASVAKRAPNAHNLSHKKEIQQWRKSFLYSLVFGIPVVVLMIYMQIPNGEDHGSKVLEQNLIPGLSILNLLFFILCTFVQFLGGWYFYVQAYKSLRHKTANMDVLIVLATTIAYVYSCVILVVAILEKAEKSPVTFFDTPPMLFVFIALGRWLEHIAKGKTSEALAKLMSLQATEATVVTLGPGHSIVREEQVPVELVQRGDIIKVVPGGKFPVDGKVIDGSSMADESLITGEPMPVVKKPGSTVIAGSINAYGSLLVNATHVGSDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLIAWITIGFVNFDIIKKYFPNQSKNISKAEIILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHQIKTVMFDKTGTITYGVPKVMRVLLMGDTAVLPLKKVLAVVGTAEASSEHPLGMAVTKYCKEELGTESLGYCTDFQAVPGCGISCKVGGVEAILGTAEEAPNKLDANRTGDSSAPLGDNGVIPLLESQGPSASEKYSVLIGNREWMRRNGLNIANDVNDAMTNHEMKGQTAILAAIDGALCGMIAIADTVKQEAALAVHTLQSMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNGKKKVAMVGDGVNDSPALAKADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLILALIYNLLGIPIAAGVFMPVGLVLQPWMGSAAMAASSVSVLLSSLQLKCYKKPDTESYEAQAQGRMKPLTPSQISVHIGMDDRRRDSSKPSPWDQTSQVSLSSLASDRLPRHNGFIQEEGGKWSLLINGADEEQYI"
misc_feature 202..390 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(220..228,235..237) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 457..648 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(475..483,490..492) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 793..969 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(811..819,826..828) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1093..1284 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1111..1119,1126..1128) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1459..1650 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1477..1485,1492..1494) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1687..1878 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1705..1713,1720..1722) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1942..4083 /gene="ATP7B" /note="P-type heavy metal-transporting ATPase, similar to human copper-transporting ATPases, ATP7A and ATP7B; Region: P-type_ATPase_Cu-like; cd02094" /db_xref="CDD:319783" misc_feature order(2935..2937,2941..2943,4012..4014) /gene="ATP7B" /note="putative Cu binding site [ion binding]; other site" /db_xref="CDD:319783" misc_feature order(3067..3075,3277..3279,3463..3471,3559..3561, 3679..3687,3745..3747,3754..3756,3763..3765,3820..3822, 3829..3831) /gene="ATP7B" /note="putative ATP binding site [chemical binding]; other site" /db_xref="CDD:319783" ORIGIN
gtctgaactgtgaaaatgcctgggactgtttttagtaggcggaatctcagatcattcatatacagagctttgtccaacattgattctcctcctggctgtgagctgaagcctacaatgaaacataattttgcttttgacaacatgggctatgaggcgagctctgaaaccatgccctctccaccttcccaagagcatattgtggtactcaacattgtgggaatgacttgccaatcatgtgtgcagtcgatagaaggccgaatttccaaggtgaagggcattttgagaattaaagtctcccttgaacagaacaatgctgttatcaagtatcggcagtcggaaataagccctgaacagatttgccaggaaattctggatatgggctttgacgccaacatagcagaagagaagttgacaacagcaactgtaaattttccaagcttgaaagaagcagtagctaagcttcgggtagaaggcatgacctgccagtcctgtgtcaccaacattgaaggaaagattaggaaactgcatggagtggcaaaaatcaaggtgtcacttgataaccaagaagcaattattgtttaccatccttacatcattcagcctgatgacctcaagagacacatcagtgacctggggtatgactgcaccattaaaagtaaatcagcccctttgaagctgggtgcccttgatctccagcgcttgcagaatgcaaaccccagggagacacctgcaagccttgatagtgatgggctggacctgctggtccccaagatgggtagcacagcaacagtgactgtacagatagagggcatgcactgcaagtcctgtgtcagaaacatcgaaggaaatatatcagatcttcctggcataaaaagtattaaagtgtctttggagcataaatgtgctgtggtacagtacagccctgatttaatcaccctgtcagctttccagcaagctatcgaatcccttccacctggaaactttaaagtaagcctccttagtggttcagaagcaaataaagcagcatcttcctcaggtgctttcacatacaatgtcgtcagacagccgccacaaggcatgacacatgtggctgttattaagattgatggcatgacctgccattcttgtgtacagtccatagaaggggccgtatcacagaggcagggggtgcagaatgtagcagtttctctagctggcagtactgggaccatacactatgatccagctgtcactagtggagaagaattaagagctgccatagaagatatgggatttgatgcctctgtgctgacagacaccgcccctggagaacacaggtgccagcctgatggcagcaaagctgctgtgcagtctcaagcttcagagcctcctcaccatggcaattccccagatgctcttctagacagtcctcaccctgatgggtcaaaccagctcagtggagccatagaagaaaagtgtgttttacagatcacaggcatgacctgtgcatcgtgtgtgtctaccattgaaagaaatttgcagaaagaagatggaattgtttcagtgttggtagcactgatggcaggtaaagcagagataaaatacaagccagaactcatacagcctcttgaaatagcacagctgatccagaatttgggttttgaagctaccatcatggaaaataatgcagaaacagaagggcaagtggagcttcttattacagggatgacttgtgcttcttgtgttcacaatattgaatccaaactcatgagaacaaatggcatattctctgcctcagttgcacttgcaactagcaaagctcacatccagtttgatcctgaaattattggacctcgagatattataaaagtaatcaaggaaattggctttcatgcttctgtggctaaaagagctccaaatgcacataacctaagtcataaaaaggaaatacagcagtggaggaaatctttcttatacagcctagtgtttggtatccctgttgtagtcttaatgatttatatgcaaatacccaatggtgaagaccatgggtctaaggtgctggaacagaacctcattcctggattatctattttgaatcttctcttttttatcctgtgcacttttgttcagttccttggtggatggtatttttatgtgcaagcctacaagtccctgaggcacaagacagccaatatggatgtgctcatcgtgctggccacgacgattgcttatgtgtattcctgtgtgatcctggtagtagcaatccttgaaaaggcagagaaaagccctgtcactttcttcgacactcctcccatgttgtttgtgttcattgcacttggcagatggctggaacacatagccaagggcaagacctcagaagctcttgctaagcttatgtctcttcaagccacagaagccactgtggtgactcttggacctggccactctattgtcagggaggagcaagtacctgttgaactggttcagaggggtgatattataaaagttgttcctggtggaaagttcccagtggatggaaaggtcattgatggcagttctatggcagatgagtctctcattaccggggaacctatgccagtcgttaaaaagcctgggagcacagtgattgctggttctataaatgcatatggctcacttcttgttaatgcaactcatgttggtagtgataccactctggcacagattgtgaaattggtggaagaagctcaaatgtcaaaggcacctatccagcaactggcagataaatttagtggatactttgttccatttatcatcatcatttcaactgtgacattgatagcatggatcacaattggttttgtaaactttgatattattaaaaaatattttcctaatcagagcaaaaacatttcaaaagctgaaataattctgaggtttgcatttcaaacctcaatcactgtgctgagcattgcatgcccttgctctttaggcctggctacccccacagctgtaatggtgggcacaggagtggctgcacagaatggaattctcatcaaaggtggaaaacccctggaaatggcacatcagatcaagactgtgatgtttgataaaactgggaccatcacctatggagttcctaaagtcatgagggtgcttttgatgggagacacagctgtgctccccctgaagaaggtactggctgttgttggtacagcagaagccagcagcgagcatcctttaggaatggctgtcactaaatactgcaaagaggagcttggcactgagagcctgggatactgcacggacttccaggcagtccccggctgtggtatcagctgcaaggtcggaggagttgaggccatccttggcacagctgaggaagctcccaataagctggatgctaacaggactggggacagcagtgctcctctgggagataatggagttatcccactcttggaatcacaaggtccatcagcttctgagaaatactcggtgttgatcggaaatcgtgaatggatgcgacgcaacggcttgaatattgcaaatgatgtaaatgatgcaatgacaaaccatgaaatgaaaggacagactgccatactagcggctatagatggtgcgttgtgcggaatgatcgccatagcagacaccgtcaagcaggaggcagcccttgctgtgcacacactgcagagcatgggaatagacgtggtgctcataacaggggacaacaggaaaactgcaaaagccattgctactcaggttgggatcaaaaaagtctttgcggaggttcttccttctcataaggttgcaaaggtccaggagctccaaaatggaaagaagaaggttgcaatggttggtgatggagtcaacgattcccctgcactagccaaggccgatgttggaattgcaattggaacgggcaccgatgttgccattgaagctgcagatgttgttcttatccgaaatgatttgctggatgtagttgccagtattcacttgtccaagagaacagttcgaagaatacgaataaatctgattcttgccttaatttataatctgcttggaatacccatagcagcaggtgtgttcatgcctgttggccttgtgcttcagccttggatggggtcagctgcaatggcagcttcttctgtgtctgtcctgctgtcttcactacagctgaaatgttacaagaagccagacacagaaagttacgaagcacaagctcaaggccgcatgaagccactcactccttctcaaatcagtgtccacattggaatggacgataggaggagggactcttccaaaccgtctccttgggaccagacaagccaagtgtccctctcctccttggcttcagacagactgccaagacacaatggcttcatccaggaggaagggggcaaatggtcattgctcataaacggagcagatgaggagcagtacatctga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]