GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-25 01:22:52, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_030949573            4410 bp    mRNA    linear   VRT 26-SEP-2019
DEFINITION  PREDICTED: Camarhynchus parvulus ATPase copper transporting beta
            (ATP7B), transcript variant X2, mRNA.
ACCESSION   XM_030949573
VERSION     XM_030949573.1
DBLINK      BioProject: PRJNA566393
KEYWORDS    RefSeq.
SOURCE      Camarhynchus parvulus
  ORGANISM  Camarhynchus parvulus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Passeriformes; Thraupidae;
            Camarhynchus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_044571.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Camarhynchus parvulus Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4410
                     /organism="Camarhynchus parvulus"
                     /mol_type="mRNA"
                     /db_xref="taxon:87175"
                     /chromosome="1"
     gene            1..4410
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 8 Proteins, and 78% coverage of
                     the annotated genomic feature by RNAseq alignments"
                     /db_xref="GeneID:115904287"
     CDS             16..4410
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X2"
                     /protein_id="XP_030805433.1"
                     /db_xref="GeneID:115904287"
                     /translation="
MPGTVFSRRNLRSFIYRALSNIDSPPGCELKPTMKHNFAFDNMGYEASSETMPSPPSQEHIVVLNIVGMTCQSCVQSIEGRISKVKGILRIKVSLEQNNAVIKYRQSEISPEQICQEILDMGFDANIAEEKLTTATVNFPSLKEAVAKLRVEGMTCQSCVTNIEGKIRKLHGVAKIKVSLDNQEAIIVYHPYIIQPDDLKRHISDLGYDCTIKSKSAPLKLGALDLQRLQNANPRETPASLDSDGLDLLVPKMGSTATVTVQIEGMHCKSCVRNIEGNISDLPGIKSIKVSLEHKCAVVQYSPDLITLSAFQQAIESLPPGNFKVSLLSGSEANKAASSSGAFTYNVVRQPPQGMTHVAVIKIDGMTCHSCVQSIEGAVSQRQGVQNVAVSLAGSTGTIHYDPAVTSGEELRAAIEDMGFDASVLTDTAPGEHRCQPDGSKAAVQSQASEPPHHGNSPDALLDSPHPDGSNQLSGAIEEKCVLQITGMTCASCVSTIERNLQKEDGIVSVLVALMAGKAEIKYKPELIQPLEIAQLIQNLGFEATIMENNAETEGQVELLITGMTCASCVHNIESKLMRTNGIFSASVALATSKAHIQFDPEIIGPRDIIKVIKEIGFHASVAKRAPNAHNLSHKKEIQQWRKSFLYSLVFGIPVVVLMIYMQIPNGEDHGSKVLEQNLIPGLSILNLLFFILCTFVQFLGGWYFYVQAYKSLRHKTANMDVLIVLATTIAYVYSCVILVVAILEKAEKSPVTFFDTPPMLFVFIALGRWLEHIAKGKTSEALAKLMSLQATEATVVTLGPGHSIVREEQVPVELVQRGDIIKVVPGGKFPVDGKVIDGSSMADESLITGEPMPVVKKPGSTVIAGSINAYGSLLVNATHVGSDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLIAWITIGFVNFDIIKKYFPNQSKNISKAEIILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHQIKTVMFDKTGTITYGVPKVMRVLLMGDTAVLPLKKVLAVVGTAEASSEHPLGMAVTKYCKEELGTESLGYCTDFQAVPGCGISCKVGGVEAILGTAEEAPNKLDANRTGDSSAPLGDNGVIPLLESQGPSASEKYSVLIGNREWMRRNGLNIANDVNDAMTNHEMKGQTAILAAIDGALCGMIAIADTVKQEAALAVHTLQSMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNGKKKVAMVGDGVNDSPALAKADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLILALIYNLLGIPIAAGVFMPVGLVLQPWMGSAAMAASSVSVLLSSLQLKCYKKPDTESYEAQAQGRMKPLTPSQISVHIGMDDRRRDSSKPSPWDQTSQVSLSSLASDRLPRHNGFIQEEGGKWSLLINGADEEQYI"
     misc_feature    202..390
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(220..228,235..237)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    457..648
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(475..483,490..492)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    793..969
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(811..819,826..828)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1093..1284
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1111..1119,1126..1128)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1459..1650
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1477..1485,1492..1494)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1687..1878
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1705..1713,1720..1722)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1942..4083
                     /gene="ATP7B"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(2935..2937,2941..2943,4012..4014)
                     /gene="ATP7B"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(3067..3075,3277..3279,3463..3471,3559..3561,
                     3679..3687,3745..3747,3754..3756,3763..3765,3820..3822,
                     3829..3831)
                     /gene="ATP7B"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      
gtctgaactgtgaaaatgcctgggactgtttttagtaggcggaatctcagatcattcatatacagagctttgtccaacattgattctcctcctggctgtgagctgaagcctacaatgaaacataattttgcttttgacaacatgggctatgaggcgagctctgaaaccatgccctctccaccttcccaagagcatattgtggtactcaacattgtgggaatgacttgccaatcatgtgtgcagtcgatagaaggccgaatttccaaggtgaagggcattttgagaattaaagtctcccttgaacagaacaatgctgttatcaagtatcggcagtcggaaataagccctgaacagatttgccaggaaattctggatatgggctttgacgccaacatagcagaagagaagttgacaacagcaactgtaaattttccaagcttgaaagaagcagtagctaagcttcgggtagaaggcatgacctgccagtcctgtgtcaccaacattgaaggaaagattaggaaactgcatggagtggcaaaaatcaaggtgtcacttgataaccaagaagcaattattgtttaccatccttacatcattcagcctgatgacctcaagagacacatcagtgacctggggtatgactgcaccattaaaagtaaatcagcccctttgaagctgggtgcccttgatctccagcgcttgcagaatgcaaaccccagggagacacctgcaagccttgatagtgatgggctggacctgctggtccccaagatgggtagcacagcaacagtgactgtacagatagagggcatgcactgcaagtcctgtgtcagaaacatcgaaggaaatatatcagatcttcctggcataaaaagtattaaagtgtctttggagcataaatgtgctgtggtacagtacagccctgatttaatcaccctgtcagctttccagcaagctatcgaatcccttccacctggaaactttaaagtaagcctccttagtggttcagaagcaaataaagcagcatcttcctcaggtgctttcacatacaatgtcgtcagacagccgccacaaggcatgacacatgtggctgttattaagattgatggcatgacctgccattcttgtgtacagtccatagaaggggccgtatcacagaggcagggggtgcagaatgtagcagtttctctagctggcagtactgggaccatacactatgatccagctgtcactagtggagaagaattaagagctgccatagaagatatgggatttgatgcctctgtgctgacagacaccgcccctggagaacacaggtgccagcctgatggcagcaaagctgctgtgcagtctcaagcttcagagcctcctcaccatggcaattccccagatgctcttctagacagtcctcaccctgatgggtcaaaccagctcagtggagccatagaagaaaagtgtgttttacagatcacaggcatgacctgtgcatcgtgtgtgtctaccattgaaagaaatttgcagaaagaagatggaattgtttcagtgttggtagcactgatggcaggtaaagcagagataaaatacaagccagaactcatacagcctcttgaaatagcacagctgatccagaatttgggttttgaagctaccatcatggaaaataatgcagaaacagaagggcaagtggagcttcttattacagggatgacttgtgcttcttgtgttcacaatattgaatccaaactcatgagaacaaatggcatattctctgcctcagttgcacttgcaactagcaaagctcacatccagtttgatcctgaaattattggacctcgagatattataaaagtaatcaaggaaattggctttcatgcttctgtggctaaaagagctccaaatgcacataacctaagtcataaaaaggaaatacagcagtggaggaaatctttcttatacagcctagtgtttggtatccctgttgtagtcttaatgatttatatgcaaatacccaatggtgaagaccatgggtctaaggtgctggaacagaacctcattcctggattatctattttgaatcttctcttttttatcctgtgcacttttgttcagttccttggtggatggtatttttatgtgcaagcctacaagtccctgaggcacaagacagccaatatggatgtgctcatcgtgctggccacgacgattgcttatgtgtattcctgtgtgatcctggtagtagcaatccttgaaaaggcagagaaaagccctgtcactttcttcgacactcctcccatgttgtttgtgttcattgcacttggcagatggctggaacacatagccaagggcaagacctcagaagctcttgctaagcttatgtctcttcaagccacagaagccactgtggtgactcttggacctggccactctattgtcagggaggagcaagtacctgttgaactggttcagaggggtgatattataaaagttgttcctggtggaaagttcccagtggatggaaaggtcattgatggcagttctatggcagatgagtctctcattaccggggaacctatgccagtcgttaaaaagcctgggagcacagtgattgctggttctataaatgcatatggctcacttcttgttaatgcaactcatgttggtagtgataccactctggcacagattgtgaaattggtggaagaagctcaaatgtcaaaggcacctatccagcaactggcagataaatttagtggatactttgttccatttatcatcatcatttcaactgtgacattgatagcatggatcacaattggttttgtaaactttgatattattaaaaaatattttcctaatcagagcaaaaacatttcaaaagctgaaataattctgaggtttgcatttcaaacctcaatcactgtgctgagcattgcatgcccttgctctttaggcctggctacccccacagctgtaatggtgggcacaggagtggctgcacagaatggaattctcatcaaaggtggaaaacccctggaaatggcacatcagatcaagactgtgatgtttgataaaactgggaccatcacctatggagttcctaaagtcatgagggtgcttttgatgggagacacagctgtgctccccctgaagaaggtactggctgttgttggtacagcagaagccagcagcgagcatcctttaggaatggctgtcactaaatactgcaaagaggagcttggcactgagagcctgggatactgcacggacttccaggcagtccccggctgtggtatcagctgcaaggtcggaggagttgaggccatccttggcacagctgaggaagctcccaataagctggatgctaacaggactggggacagcagtgctcctctgggagataatggagttatcccactcttggaatcacaaggtccatcagcttctgagaaatactcggtgttgatcggaaatcgtgaatggatgcgacgcaacggcttgaatattgcaaatgatgtaaatgatgcaatgacaaaccatgaaatgaaaggacagactgccatactagcggctatagatggtgcgttgtgcggaatgatcgccatagcagacaccgtcaagcaggaggcagcccttgctgtgcacacactgcagagcatgggaatagacgtggtgctcataacaggggacaacaggaaaactgcaaaagccattgctactcaggttgggatcaaaaaagtctttgcggaggttcttccttctcataaggttgcaaaggtccaggagctccaaaatggaaagaagaaggttgcaatggttggtgatggagtcaacgattcccctgcactagccaaggccgatgttggaattgcaattggaacgggcaccgatgttgccattgaagctgcagatgttgttcttatccgaaatgatttgctggatgtagttgccagtattcacttgtccaagagaacagttcgaagaatacgaataaatctgattcttgccttaatttataatctgcttggaatacccatagcagcaggtgtgttcatgcctgttggccttgtgcttcagccttggatggggtcagctgcaatggcagcttcttctgtgtctgtcctgctgtcttcactacagctgaaatgttacaagaagccagacacagaaagttacgaagcacaagctcaaggccgcatgaagccactcactccttctcaaatcagtgtccacattggaatggacgataggaggagggactcttccaaaccgtctccttgggaccagacaagccaagtgtccctctcctccttggcttcagacagactgccaagacacaatggcttcatccaggaggaagggggcaaatggtcattgctcataaacggagcagatgaggagcagtacatctga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]