GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 11:38:41, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_030949564            4593 bp    mRNA    linear   VRT 26-SEP-2019
DEFINITION  PREDICTED: Camarhynchus parvulus ATPase copper transporting beta
            (ATP7B), transcript variant X1, mRNA.
ACCESSION   XM_030949564
VERSION     XM_030949564.1
DBLINK      BioProject: PRJNA566393
KEYWORDS    RefSeq.
SOURCE      Camarhynchus parvulus
  ORGANISM  Camarhynchus parvulus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Passeriformes; Thraupidae;
            Camarhynchus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_044571.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Camarhynchus parvulus Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4593
                     /organism="Camarhynchus parvulus"
                     /mol_type="mRNA"
                     /db_xref="taxon:87175"
                     /chromosome="1"
     gene            1..4593
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 9 Proteins, and 78% coverage of
                     the annotated genomic feature by RNAseq alignments"
                     /db_xref="GeneID:115904287"
     CDS             1..4593
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X1"
                     /protein_id="XP_030805424.1"
                     /db_xref="GeneID:115904287"
                     /translation="
MERKLDNKMKKELSYLATLNDRNISLLSIHKQQAARDVPELLIIGEKSKMASPPKASSNLQKEEKLSQSYSMGMTEVSTDERQALSNIDSPPGCELKPTMKHNFAFDNMGYEASSETMPSPPSQEHIVVLNIVGMTCQSCVQSIEGRISKVKGILRIKVSLEQNNAVIKYRQSEISPEQICQEILDMGFDANIAEEKLTTATVNFPSLKEAVAKLRVEGMTCQSCVTNIEGKIRKLHGVAKIKVSLDNQEAIIVYHPYIIQPDDLKRHISDLGYDCTIKSKSAPLKLGALDLQRLQNANPRETPASLDSDGLDLLVPKMGSTATVTVQIEGMHCKSCVRNIEGNISDLPGIKSIKVSLEHKCAVVQYSPDLITLSAFQQAIESLPPGNFKVSLLSGSEANKAASSSGAFTYNVVRQPPQGMTHVAVIKIDGMTCHSCVQSIEGAVSQRQGVQNVAVSLAGSTGTIHYDPAVTSGEELRAAIEDMGFDASVLTDTAPGEHRCQPDGSKAAVQSQASEPPHHGNSPDALLDSPHPDGSNQLSGAIEEKCVLQITGMTCASCVSTIERNLQKEDGIVSVLVALMAGKAEIKYKPELIQPLEIAQLIQNLGFEATIMENNAETEGQVELLITGMTCASCVHNIESKLMRTNGIFSASVALATSKAHIQFDPEIIGPRDIIKVIKEIGFHASVAKRAPNAHNLSHKKEIQQWRKSFLYSLVFGIPVVVLMIYMQIPNGEDHGSKVLEQNLIPGLSILNLLFFILCTFVQFLGGWYFYVQAYKSLRHKTANMDVLIVLATTIAYVYSCVILVVAILEKAEKSPVTFFDTPPMLFVFIALGRWLEHIAKGKTSEALAKLMSLQATEATVVTLGPGHSIVREEQVPVELVQRGDIIKVVPGGKFPVDGKVIDGSSMADESLITGEPMPVVKKPGSTVIAGSINAYGSLLVNATHVGSDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLIAWITIGFVNFDIIKKYFPNQSKNISKAEIILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHQIKTVMFDKTGTITYGVPKVMRVLLMGDTAVLPLKKVLAVVGTAEASSEHPLGMAVTKYCKEELGTESLGYCTDFQAVPGCGISCKVGGVEAILGTAEEAPNKLDANRTGDSSAPLGDNGVIPLLESQGPSASEKYSVLIGNREWMRRNGLNIANDVNDAMTNHEMKGQTAILAAIDGALCGMIAIADTVKQEAALAVHTLQSMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNGKKKVAMVGDGVNDSPALAKADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLILALIYNLLGIPIAAGVFMPVGLVLQPWMGSAAMAASSVSVLLSSLQLKCYKKPDTESYEAQAQGRMKPLTPSQISVHIGMDDRRRDSSKPSPWDQTSQVSLSSLASDRLPRHNGFIQEEGGKWSLLINGADEEQYI"
ORIGIN      
atggagagaaaactggacaataaaatgaaaaaggaactgtcctacttagctactttaaacgacagaaacatatccttgctgtctattcataagcagcaggcagctcgtgatgtgcctgaactactgattattggtgaaaagtccaagatggcatctccgccaaaagcaagcagtaacttgcagaaagaagagaaactttcgcagagttactccatgggcatgacagaagtcagtacagatgaaaggcaggctttgtccaacattgattctcctcctggctgtgagctgaagcctacaatgaaacataattttgcttttgacaacatgggctatgaggcgagctctgaaaccatgccctctccaccttcccaagagcatattgtggtactcaacattgtgggaatgacttgccaatcatgtgtgcagtcgatagaaggccgaatttccaaggtgaagggcattttgagaattaaagtctcccttgaacagaacaatgctgttatcaagtatcggcagtcggaaataagccctgaacagatttgccaggaaattctggatatgggctttgacgccaacatagcagaagagaagttgacaacagcaactgtaaattttccaagcttgaaagaagcagtagctaagcttcgggtagaaggcatgacctgccagtcctgtgtcaccaacattgaaggaaagattaggaaactgcatggagtggcaaaaatcaaggtgtcacttgataaccaagaagcaattattgtttaccatccttacatcattcagcctgatgacctcaagagacacatcagtgacctggggtatgactgcaccattaaaagtaaatcagcccctttgaagctgggtgcccttgatctccagcgcttgcagaatgcaaaccccagggagacacctgcaagccttgatagtgatgggctggacctgctggtccccaagatgggtagcacagcaacagtgactgtacagatagagggcatgcactgcaagtcctgtgtcagaaacatcgaaggaaatatatcagatcttcctggcataaaaagtattaaagtgtctttggagcataaatgtgctgtggtacagtacagccctgatttaatcaccctgtcagctttccagcaagctatcgaatcccttccacctggaaactttaaagtaagcctccttagtggttcagaagcaaataaagcagcatcttcctcaggtgctttcacatacaatgtcgtcagacagccgccacaaggcatgacacatgtggctgttattaagattgatggcatgacctgccattcttgtgtacagtccatagaaggggccgtatcacagaggcagggggtgcagaatgtagcagtttctctagctggcagtactgggaccatacactatgatccagctgtcactagtggagaagaattaagagctgccatagaagatatgggatttgatgcctctgtgctgacagacaccgcccctggagaacacaggtgccagcctgatggcagcaaagctgctgtgcagtctcaagcttcagagcctcctcaccatggcaattccccagatgctcttctagacagtcctcaccctgatgggtcaaaccagctcagtggagccatagaagaaaagtgtgttttacagatcacaggcatgacctgtgcatcgtgtgtgtctaccattgaaagaaatttgcagaaagaagatggaattgtttcagtgttggtagcactgatggcaggtaaagcagagataaaatacaagccagaactcatacagcctcttgaaatagcacagctgatccagaatttgggttttgaagctaccatcatggaaaataatgcagaaacagaagggcaagtggagcttcttattacagggatgacttgtgcttcttgtgttcacaatattgaatccaaactcatgagaacaaatggcatattctctgcctcagttgcacttgcaactagcaaagctcacatccagtttgatcctgaaattattggacctcgagatattataaaagtaatcaaggaaattggctttcatgcttctgtggctaaaagagctccaaatgcacataacctaagtcataaaaaggaaatacagcagtggaggaaatctttcttatacagcctagtgtttggtatccctgttgtagtcttaatgatttatatgcaaatacccaatggtgaagaccatgggtctaaggtgctggaacagaacctcattcctggattatctattttgaatcttctcttttttatcctgtgcacttttgttcagttccttggtggatggtatttttatgtgcaagcctacaagtccctgaggcacaagacagccaatatggatgtgctcatcgtgctggccacgacgattgcttatgtgtattcctgtgtgatcctggtagtagcaatccttgaaaaggcagagaaaagccctgtcactttcttcgacactcctcccatgttgtttgtgttcattgcacttggcagatggctggaacacatagccaagggcaagacctcagaagctcttgctaagcttatgtctcttcaagccacagaagccactgtggtgactcttggacctggccactctattgtcagggaggagcaagtacctgttgaactggttcagaggggtgatattataaaagttgttcctggtggaaagttcccagtggatggaaaggtcattgatggcagttctatggcagatgagtctctcattaccggggaacctatgccagtcgttaaaaagcctgggagcacagtgattgctggttctataaatgcatatggctcacttcttgttaatgcaactcatgttggtagtgataccactctggcacagattgtgaaattggtggaagaagctcaaatgtcaaaggcacctatccagcaactggcagataaatttagtggatactttgttccatttatcatcatcatttcaactgtgacattgatagcatggatcacaattggttttgtaaactttgatattattaaaaaatattttcctaatcagagcaaaaacatttcaaaagctgaaataattctgaggtttgcatttcaaacctcaatcactgtgctgagcattgcatgcccttgctctttaggcctggctacccccacagctgtaatggtgggcacaggagtggctgcacagaatggaattctcatcaaaggtggaaaacccctggaaatggcacatcagatcaagactgtgatgtttgataaaactgggaccatcacctatggagttcctaaagtcatgagggtgcttttgatgggagacacagctgtgctccccctgaagaaggtactggctgttgttggtacagcagaagccagcagcgagcatcctttaggaatggctgtcactaaatactgcaaagaggagcttggcactgagagcctgggatactgcacggacttccaggcagtccccggctgtggtatcagctgcaaggtcggaggagttgaggccatccttggcacagctgaggaagctcccaataagctggatgctaacaggactggggacagcagtgctcctctgggagataatggagttatcccactcttggaatcacaaggtccatcagcttctgagaaatactcggtgttgatcggaaatcgtgaatggatgcgacgcaacggcttgaatattgcaaatgatgtaaatgatgcaatgacaaaccatgaaatgaaaggacagactgccatactagcggctatagatggtgcgttgtgcggaatgatcgccatagcagacaccgtcaagcaggaggcagcccttgctgtgcacacactgcagagcatgggaatagacgtggtgctcataacaggggacaacaggaaaactgcaaaagccattgctactcaggttgggatcaaaaaagtctttgcggaggttcttccttctcataaggttgcaaaggtccaggagctccaaaatggaaagaagaaggttgcaatggttggtgatggagtcaacgattcccctgcactagccaaggccgatgttggaattgcaattggaacgggcaccgatgttgccattgaagctgcagatgttgttcttatccgaaatgatttgctggatgtagttgccagtattcacttgtccaagagaacagttcgaagaatacgaataaatctgattcttgccttaatttataatctgcttggaatacccatagcagcaggtgtgttcatgcctgttggccttgtgcttcagccttggatggggtcagctgcaatggcagcttcttctgtgtctgtcctgctgtcttcactacagctgaaatgttacaagaagccagacacagaaagttacgaagcacaagctcaaggccgcatgaagccactcactccttctcaaatcagtgtccacattggaatggacgataggaggagggactcttccaaaccgtctccttgggaccagacaagccaagtgtccctctcctccttggcttcagacagactgccaagacacaatggcttcatccaggaggaagggggcaaatggtcattgctcataaacggagcagatgaggagcagtacatctga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]