LOCUS       XM_030949564            4593 bp    mRNA    linear   VRT 26-SEP-2019
DEFINITION  PREDICTED: Camarhynchus parvulus ATPase copper transporting beta
            (ATP7B), transcript variant X1, mRNA.
ACCESSION   XM_030949564
VERSION     XM_030949564.1
DBLINK      BioProject: PRJNA566393
KEYWORDS    RefSeq.
SOURCE      Camarhynchus parvulus
  ORGANISM  Camarhynchus parvulus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Passeriformes; Thraupidae;
            Camarhynchus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_044571.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Camarhynchus parvulus Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4593
                     /organism="Camarhynchus parvulus"
                     /mol_type="mRNA"
                     /db_xref="taxon:87175"
                     /chromosome="1"
     gene            1..4593
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 9 Proteins, and 78% coverage of
                     the annotated genomic feature by RNAseq alignments"
                     /db_xref="GeneID:115904287"
     CDS             1..4593
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X1"
                     /protein_id="XP_030805424.1"
                     /db_xref="GeneID:115904287"
                     /translation="

MERKLDNKMKKELSYLATLNDRNISLLSIHKQQAARDVPELLIIGEKSKMASPPKASSNLQKEEKLSQSYSMGMTEVSTDERQALSNIDSPPGCELKPTMKHNFAFDNMGYEASSETMPSPPSQEHIVVLNIVGMTCQSCVQSIEGRISKVKGILRIKVSLEQNNAVIKYRQSEISPEQICQEILDMGFDANIAEEKLTTATVNFPSLKEAVAKLRVEGMTCQSCVTNIEGKIRKLHGVAKIKVSLDNQEAIIVYHPYIIQPDDLKRHISDLGYDCTIKSKSAPLKLGALDLQRLQNANPRETPASLDSDGLDLLVPKMGSTATVTVQIEGMHCKSCVRNIEGNISDLPGIKSIKVSLEHKCAVVQYSPDLITLSAFQQAIESLPPGNFKVSLLSGSEANKAASSSGAFTYNVVRQPPQGMTHVAVIKIDGMTCHSCVQSIEGAVSQRQGVQNVAVSLAGSTGTIHYDPAVTSGEELRAAIEDMGFDASVLTDTAPGEHRCQPDGSKAAVQSQASEPPHHGNSPDALLDSPHPDGSNQLSGAIEEKCVLQITGMTCASCVSTIERNLQKEDGIVSVLVALMAGKAEIKYKPELIQPLEIAQLIQNLGFEATIMENNAETEGQVELLITGMTCASCVHNIESKLMRTNGIFSASVALATSKAHIQFDPEIIGPRDIIKVIKEIGFHASVAKRAPNAHNLSHKKEIQQWRKSFLYSLVFGIPVVVLMIYMQIPNGEDHGSKVLEQNLIPGLSILNLLFFILCTFVQFLGGWYFYVQAYKSLRHKTANMDVLIVLATTIAYVYSCVILVVAILEKAEKSPVTFFDTPPMLFVFIALGRWLEHIAKGKTSEALAKLMSLQATEATVVTLGPGHSIVREEQVPVELVQRGDIIKVVPGGKFPVDGKVIDGSSMADESLITGEPMPVVKKPGSTVIAGSINAYGSLLVNATHVGSDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLIAWITIGFVNFDIIKKYFPNQSKNISKAEIILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHQIKTVMFDKTGTITYGVPKVMRVLLMGDTAVLPLKKVLAVVGTAEASSEHPLGMAVTKYCKEELGTESLGYCTDFQAVPGCGISCKVGGVEAILGTAEEAPNKLDANRTGDSSAPLGDNGVIPLLESQGPSASEKYSVLIGNREWMRRNGLNIANDVNDAMTNHEMKGQTAILAAIDGALCGMIAIADTVKQEAALAVHTLQSMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNGKKKVAMVGDGVNDSPALAKADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLILALIYNLLGIPIAAGVFMPVGLVLQPWMGSAAMAASSVSVLLSSLQLKCYKKPDTESYEAQAQGRMKPLTPSQISVHIGMDDRRRDSSKPSPWDQTSQVSLSSLASDRLPRHNGFIQEEGGKWSLLINGADEEQYI"

     misc_feature    385..573
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(403..411,418..420)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    640..831
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(658..666,673..675)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    976..1152
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(994..1002,1009..1011)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1276..1467
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1294..1302,1309..1311)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1642..1833
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1660..1668,1675..1677)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1870..2061
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1888..1896,1903..1905)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2125..4266
                     /gene="ATP7B"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(3118..3120,3124..3126,4195..4197)
                     /gene="ATP7B"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(3250..3258,3460..3462,3646..3654,3742..3744,
                     3862..3870,3928..3930,3937..3939,3946..3948,4003..4005,
                     4012..4014)
                     /gene="ATP7B"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      

atggagagaaaactggacaataaaatgaaaaaggaactgtcctacttagctactttaaacgacagaaacatatccttgctgtctattcataagcagcaggcagctcgtgatgtgcctgaactactgattattggtgaaaagtccaagatggcatctccgccaaaagcaagcagtaacttgcagaaagaagagaaactttcgcagagttactccatgggcatgacagaagtcagtacagatgaaaggcaggctttgtccaacattgattctcctcctggctgtgagctgaagcctacaatgaaacataattttgcttttgacaacatgggctatgaggcgagctctgaaaccatgccctctccaccttcccaagagcatattgtggtactcaacattgtgggaatgacttgccaatcatgtgtgcagtcgatagaaggccgaatttccaaggtgaagggcattttgagaattaaagtctcccttgaacagaacaatgctgttatcaagtatcggcagtcggaaataagccctgaacagatttgccaggaaattctggatatgggctttgacgccaacatagcagaagagaagttgacaacagcaactgtaaattttccaagcttgaaagaagcagtagctaagcttcgggtagaaggcatgacctgccagtcctgtgtcaccaacattgaaggaaagattaggaaactgcatggagtggcaaaaatcaaggtgtcacttgataaccaagaagcaattattgtttaccatccttacatcattcagcctgatgacctcaagagacacatcagtgacctggggtatgactgcaccattaaaagtaaatcagcccctttgaagctgggtgcccttgatctccagcgcttgcagaatgcaaaccccagggagacacctgcaagccttgatagtgatgggctggacctgctggtccccaagatgggtagcacagcaacagtgactgtacagatagagggcatgcactgcaagtcctgtgtcagaaacatcgaaggaaatatatcagatcttcctggcataaaaagtattaaagtgtctttggagcataaatgtgctgtggtacagtacagccctgatttaatcaccctgtcagctttccagcaagctatcgaatcccttccacctggaaactttaaagtaagcctccttagtggttcagaagcaaataaagcagcatcttcctcaggtgctttcacatacaatgtcgtcagacagccgccacaaggcatgacacatgtggctgttattaagattgatggcatgacctgccattcttgtgtacagtccatagaaggggccgtatcacagaggcagggggtgcagaatgtagcagtttctctagctggcagtactgggaccatacactatgatccagctgtcactagtggagaagaattaagagctgccatagaagatatgggatttgatgcctctgtgctgacagacaccgcccctggagaacacaggtgccagcctgatggcagcaaagctgctgtgcagtctcaagcttcagagcctcctcaccatggcaattccccagatgctcttctagacagtcctcaccctgatgggtcaaaccagctcagtggagccatagaagaaaagtgtgttttacagatcacaggcatgacctgtgcatcgtgtgtgtctaccattgaaagaaatttgcagaaagaagatggaattgtttcagtgttggtagcactgatggcaggtaaagcagagataaaatacaagccagaactcatacagcctcttgaaatagcacagctgatccagaatttgggttttgaagctaccatcatggaaaataatgcagaaacagaagggcaagtggagcttcttattacagggatgacttgtgcttcttgtgttcacaatattgaatccaaactcatgagaacaaatggcatattctctgcctcagttgcacttgcaactagcaaagctcacatccagtttgatcctgaaattattggacctcgagatattataaaagtaatcaaggaaattggctttcatgcttctgtggctaaaagagctccaaatgcacataacctaagtcataaaaaggaaatacagcagtggaggaaatctttcttatacagcctagtgtttggtatccctgttgtagtcttaatgatttatatgcaaatacccaatggtgaagaccatgggtctaaggtgctggaacagaacctcattcctggattatctattttgaatcttctcttttttatcctgtgcacttttgttcagttccttggtggatggtatttttatgtgcaagcctacaagtccctgaggcacaagacagccaatatggatgtgctcatcgtgctggccacgacgattgcttatgtgtattcctgtgtgatcctggtagtagcaatccttgaaaaggcagagaaaagccctgtcactttcttcgacactcctcccatgttgtttgtgttcattgcacttggcagatggctggaacacatagccaagggcaagacctcagaagctcttgctaagcttatgtctcttcaagccacagaagccactgtggtgactcttggacctggccactctattgtcagggaggagcaagtacctgttgaactggttcagaggggtgatattataaaagttgttcctggtggaaagttcccagtggatggaaaggtcattgatggcagttctatggcagatgagtctctcattaccggggaacctatgccagtcgttaaaaagcctgggagcacagtgattgctggttctataaatgcatatggctcacttcttgttaatgcaactcatgttggtagtgataccactctggcacagattgtgaaattggtggaagaagctcaaatgtcaaaggcacctatccagcaactggcagataaatttagtggatactttgttccatttatcatcatcatttcaactgtgacattgatagcatggatcacaattggttttgtaaactttgatattattaaaaaatattttcctaatcagagcaaaaacatttcaaaagctgaaataattctgaggtttgcatttcaaacctcaatcactgtgctgagcattgcatgcccttgctctttaggcctggctacccccacagctgtaatggtgggcacaggagtggctgcacagaatggaattctcatcaaaggtggaaaacccctggaaatggcacatcagatcaagactgtgatgtttgataaaactgggaccatcacctatggagttcctaaagtcatgagggtgcttttgatgggagacacagctgtgctccccctgaagaaggtactggctgttgttggtacagcagaagccagcagcgagcatcctttaggaatggctgtcactaaatactgcaaagaggagcttggcactgagagcctgggatactgcacggacttccaggcagtccccggctgtggtatcagctgcaaggtcggaggagttgaggccatccttggcacagctgaggaagctcccaataagctggatgctaacaggactggggacagcagtgctcctctgggagataatggagttatcccactcttggaatcacaaggtccatcagcttctgagaaatactcggtgttgatcggaaatcgtgaatggatgcgacgcaacggcttgaatattgcaaatgatgtaaatgatgcaatgacaaaccatgaaatgaaaggacagactgccatactagcggctatagatggtgcgttgtgcggaatgatcgccatagcagacaccgtcaagcaggaggcagcccttgctgtgcacacactgcagagcatgggaatagacgtggtgctcataacaggggacaacaggaaaactgcaaaagccattgctactcaggttgggatcaaaaaagtctttgcggaggttcttccttctcataaggttgcaaaggtccaggagctccaaaatggaaagaagaaggttgcaatggttggtgatggagtcaacgattcccctgcactagccaaggccgatgttggaattgcaattggaacgggcaccgatgttgccattgaagctgcagatgttgttcttatccgaaatgatttgctggatgtagttgccagtattcacttgtccaagagaacagttcgaagaatacgaataaatctgattcttgccttaatttataatctgcttggaatacccatagcagcaggtgtgttcatgcctgttggccttgtgcttcagccttggatggggtcagctgcaatggcagcttcttctgtgtctgtcctgctgtcttcactacagctgaaatgttacaagaagccagacacagaaagttacgaagcacaagctcaaggccgcatgaagccactcactccttctcaaatcagtgtccacattggaatggacgataggaggagggactcttccaaaccgtctccttgggaccagacaagccaagtgtccctctcctccttggcttcagacagactgccaagacacaatggcttcatccaggaggaagggggcaaatggtcattgctcataaacggagcagatgaggagcagtacatctga

//