2024-10-04 21:19:33, GGRNA.v2 : RefSeq release 225 (Jul, 2024)
LOCUS XM_030883596 3831 bp mRNA linear MAM 24-OCT-2023 DEFINITION PREDICTED: Globicephala melas NRDE-2, necessary for RNA interference, domain containing (NRDE2), transcript variant X1, mRNA. ACCESSION XM_030883596 VERSION XM_030883596.2 DBLINK BioProject: PRJNA1026603 KEYWORDS RefSeq. SOURCE Globicephala melas (long-finned pilot whale) ORGANISM Globicephala melas Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Whippomorpha; Cetacea; Odontoceti; Delphinidae; Globicephala. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_083315) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process On Oct 24, 2023 this sequence version replaced XM_030883596.1. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_963455315.1-RS_2023_10 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.2 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 10/19/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3831 /organism="Globicephala melas" /mol_type="mRNA" /db_xref="taxon:9731" /chromosome="2" gene 1..3831 /gene="NRDE2" /note="NRDE-2, necessary for RNA interference, domain containing; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 9 Proteins" /db_xref="GeneID:115867337" CDS 54..3551 /gene="NRDE2" /codon_start=1 /product="nuclear exosome regulator NRDE2 isoform X1" /protein_id="XP_030739456.1" /db_xref="GeneID:115867337" /translation="
MALFPAFAGVSEEPESGSPRKELDWLSNPSFCVGTITSLSQQTEEVTTFVSEESLLTRSPLNSEPSGESDTNKKPKQTSRKKKKEKKKKRKHQHHKKTKRKRGQSSSSGSESYTDSEKDISSRSIRSSKKESEKPNQENNATADIGRHFVWLEDIQALTGETFRTDKKPDPANWEYKSLYRGDVARYKRKGDSCLGINPRKQCISWEGTSTEKKRSHKHVERYFTKKSVGLMNIDGVAISSKTEPPSSESISFIPVKGAEDVVSPVTTWLNPLGIYDEATTQWLQGRGPSEQESKQPDSQPNRENVLLKAKVEEFNRRLWENPRDIQLWMAFVAFQDEVMRSPGLYAIEEGQQEKRKRSLKLVLEKKLAILERAVESNPSSVDLKLAKLQLCTEFWEPSTLVKEWQKLIFLHPNNTALWQKYLLFCQSQFSTFSISKIQSLYGKCLSTLSAVKDGSILSHPELPGTEEAMFALFLQQCHFLRQAGHSEKAVSLFQAMVDFTFFKPDSVKDLPTKGQVEFFEPFWDSGEPRAGEKGARGWRAWMQQQERGGWVVVSPDDDDDEPEDDDQEIKDKTLPRWQIWLAAERSRDHRHWRPWRPEKTKKQAEEDCEDPERQVLFDDIGQSLIQLSSPDLQFRLIAAFLQFLGVPSGFSPPASCLYLAMDENSIFDNGLYDEKPLTFLNLSFSGVSCIGRTDQLGCRHWTRGHSREGEEFIRNIFHLVMPLFSGKERSQLCFSWLQYEIAKVVWCLRTKNKKRLKSQGKNCKKLAKNLLKEPDNRNNFCLWKQYAHLEWLLGNTEDARRVFDTALGMAGSRELKDHELCELGLLYAELEVELLPDVRGAAPARAIHVLTRLTENGAYGPYTGQVLAVHILKARKAYEHALQDCLGESCVSDPAPADSFSRLISLVKCFMLFQYLTIGIDAAVRIYEQVFAKHKVSVSAEGPGLEGSASPPSLSSVLEAVTLMHTSLLRFHMKVAVYPLAPLREALSEALKLYPDNQVLWRSYVQIQNKSHSASKTRRFFDAITRSAKPLEPWLFAIEAEKMRKRLVETVQRVDGREVYATIPETGLTHRIRALFENAMRSDYGSQCPLLWRMYLNFLVSLGNKERSKGVFYKALQNCPWAKVLYLDAVEYFPDEMQEILDLMTEKELRVRLPLEELELLLED"
misc_feature 537..824 /gene="NRDE2" /note="MTR4-interacting domain (MID) found in nuclear exosome regulator NRDE2 and similar proteins; Region: NRDE2_MID; cd22200" /db_xref="CDD:412062" misc_feature order(537..563,570..575,585..590,594..596,600..644, 651..659,663..671,693..701,711..716,720..725,732..752, 777..788,798..824) /gene="NRDE2" /note="MTR4 binding site [polypeptide binding]; other site" /db_xref="CDD:412062" misc_feature 993..1991 /gene="NRDE2" /note="necessary for RNA interference; Region: NRDE-2; pfam08424" /db_xref="CDD:462472" polyA_site 3831 /gene="NRDE2" /experiment="COORDINATES: polyA evidence [ECO:0006239]" ORIGIN
tcggcttcccgccgccatttttgtggagtgaaaaggcggtgtggcctgtgaacatggcgctgttccccgcctttgcgggtgttagtgaggagcccgagagcgggagccccaggaaagaattagactggctgagcaacccaagcttttgtgttggaaccataacatctctgagccaacaaactgaagaggtcacaacctttgtttctgaagagtcgctactgaccaggagtcctctgaattcagagccttcaggtgaaagtgacactaacaaaaagcccaaacaaacaagcagaaaaaagaagaaagagaaaaagaagaaaaggaagcatcagcaccacaagaaaaccaagagaaaacgtggacagtcaagtagcagtggatctgagtcatatactgattctgaaaaagacatatcgtccagaagcatcagaagcagtaaaaaggaatcagagaaaccgaatcaagaaaataatgccactgctgatattggacgtcactttgtttggcttgaggacattcaggctctgacgggagaaaccttcagaacagataagaagccggatcctgcaaactgggagtataagtctctttaccgaggagatgtagcaagatacaagaggaaaggagactcctgccttggcattaaccctaggaagcagtgtatatcttgggaggggacttccacagaaaagaagcggtcacacaagcatgtcgagcgctactttacaaagaagagtgtgggattaatgaacattgacggagttgccattagcagtaaaactgaacctccctcatcagagtcgatctcatttatcccagtgaagggtgcagaggatgtggtttcccctgttacaacctggttgaaccctctggggatttatgatgaagccaccacgcagtggttgcaaggccggggtccttcagagcaagaatccaagcagccagattcacagcccaacagagagaacgtgcttctcaaggccaaggtggaggagtttaacaggaggctttgggagaatcctcgggacattcagctgtggatggcatttgttgcttttcaggacgaggtcatgaggagtccgggcctgtatgccatcgaggaaggacagcaggaaaagcggaagcggtccctgaagctggttctggagaagaagctggccattctggaacgggccgtggaaagcaacccgagcagcgtggatctgaaacttgccaagctgcagctctgcaccgagttctgggagccctccactctggtcaaagagtggcagaaactgatatttttacatcccaacaatacagccctttggcagaaataccttttattttgccagagccagtttagcaccttttccatatcaaaaattcagagtctttatggaaaatgcttgagtactttgtctgctgttaaggacggcagcatcttgtctcaccctgagctgcctggcactgaggaggccatgtttgccctctttcttcagcagtgccactttctgcggcaggctggtcactccgagaaggccgtctctctgttccaggccatggttgacttcaccttcttcaaacccgacagtgtgaaagacctgcctaccaaaggacaggtagaattctttgagcccttttgggacagtggagagcccagggccggggagaagggcgcccgaggctggagagcgtggatgcagcagcaggagcggggcggctgggtggtcgtcagcccagatgatgacgatgatgaaccagaagacgacgaccaggaaattaaagataagactctgcccaggtggcagatctggcttgctgctgagcggtcccgagaccacagacactggcggccgtggcgccctgagaagaccaagaagcaggcggaggaagactgtgaggacccggagaggcaggtgttgtttgatgatattggacagtctctgatccagctttccagcccggatcttcagtttcggctgattgcagcctttctgcagttcttgggtgtgccttccggcttcagccctccggcctcctgcctctatctggccatggatgagaacagcatctttgacaatggactttatgatgaaaagcccttgacttttctcaacctttcattttctggcgtcagctgtatcggacgcacagaccagctgggttgccggcactggaccaggggtcacagtcgagagggcgaggagttcatccgcaacatcttccacctcgtgatgcctttgttttcaggcaaggagaggtctcagctctgcttctcctggttacagtacgagattgcaaaggtcgtttggtgtctgcgcactaaaaacaagaagagattaaaatcacaaggaaagaactgcaaaaaactagccaagaatctcctcaaggagccagacaaccgcaacaatttttgcctctggaagcagtatgcgcatctggagtggttgctcggcaacacagaggatgccagaagagttttcgatacagcgctcggcatggcagggagcagagaactgaaggaccatgagctgtgtgagctcggtctcctctacgccgagctggaggtggagctgttgccggacgtgagaggggctgccccagcccgagccattcacgtattgaccagactgaccgagaatggggcctacgggccctacaccgggcaagtcttggccgttcacattttgaaagctcggaaggcttatgaacacgcgctgcaggactgtttgggggagagctgtgtctctgatccagctcccgccgattcctttagccgcctgattagcctggttaaatgctttatgctcttccagtatttgaccatagggatcgacgctgctgtgcggatatatgagcaggtatttgcgaaacacaaggtctctgtttccgcagagggccctggtctggagggcagtgccagccccccgagcctgagcagtgtccttgaggccgtcaccctgatgcacacgagcctgcttagattccacatgaaagtcgccgtctaccctctggctcctctgcgagaggctctctcggaggctttaaagttgtatccggacaaccaggttctttggaggtcgtatgtacagattcagaataagtcccacagtgccagtaagaccagaagattcttcgatgcgatcaccaggtctgccaaacccttggagccgtggttgttcgcaattgaagctgagaaaatgaggaaaagactagtggaaactgtgcagagggtagatggtagagaggtctacgccaccattcccgagaccggcctgacacatcggatcagagccctgtttgaaaatgcgatgcggagtgactacggcagccagtgccccttactgtggaggatgtatttgaattttttggtttccttaggaaataaagaaagaagcaaaggtgtgttctacaaagcacttcagaattgtccttgggcaaaggtgctgtacctggatgccgtggagtacttccccgatgagatgcaggagatcctggacctgatgacggagaaggagctccgggtgcgcctgccgctggaggagctggagcttctgcttgaggactagagaccaggaggggagtggggcgtgcctccgaggcctcggcgccggccccgtgggagcaggagataccagaagagacggtgacacatgcgtgcgagtgtgttaagacctctgcctttggagtttctttcttgatagtttgtgtctgggttattggtctctcacctcttgcacattgtgtgtgcaaatgacacaaaaccatcgttttgcatattatatatgtatgtgtatatatgtgcatagacaggaatcatgccaagtgataaatgaacctgtcatggtt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]