LOCUS       XM_030813435            7185 bp    mRNA    linear   PRI 17-SEP-2019
DEFINITION  PREDICTED: Nomascus leucogenys ATPase copper transporting beta
            (ATP7B), mRNA.
ACCESSION   XM_030813435
VERSION     XM_030813435.1
DBLINK      BioProject: PRJNA564096
KEYWORDS    RefSeq.
SOURCE      Nomascus leucogenys (northern white-cheeked gibbon)
  ORGANISM  Nomascus leucogenys
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hylobatidae; Nomascus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_044385.1) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Nomascus leucogenys Annotation
                                           Release 103
            Annotation Version          :: 103
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..7185
                     /organism="Nomascus leucogenys"
                     /mol_type="mRNA"
                     /isolate="Asia"
                     /bio_material="CORIELL:NLL605"
                     /db_xref="taxon:61853"
                     /chromosome="5"
                     /sex="female"
                     /tissue_type="EB transformed lymphoblast cell line"
                     /dev_stage="adult"
     gene            1..7185
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 3 mRNAs, 102 ESTs, 7 Proteins, and
                     99% coverage of the annotated genomic feature by RNAseq
                     alignments, including 1 sample with support for all
                     annotated introns"
                     /db_xref="GeneID:100603669"
     CDS             722..5119
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2"
                     /protein_id="XP_030669295.1"
                     /db_xref="GeneID:100603669"
                     /translation="

MPEQERQITAREGASRKILSKLSLPTHAWEPAMKKSFAFDNVGYEGGLDGLGPFSQVATSTVRILGMTCQSCVKSIEDRISNLKGIVSMKVSLEQGSATMKYVPSVVSLQQVCHQIGDMGFEASIAEGKAASWPSRSLPAQEAVVKLRVEGMTCQSCVSSIEGKVRKLQGVVRVKVSLSNQEAVITYQPYLIQPEDLRDHVNDMGFEAVIKNKVAPLSLGPIDIERLQSTNPKRPLSSANQNFNNSETLGHQGSHVVTLQLRIDGMHCKSCVLNIEENIGQLLGVQSIQVSLENKTAQVQYDPSCTSPVALQRAIEALPPGNFKVSLPDGAEGSGTDHRSSNSHSPGSSPRNQVQGTCSTTLIAIAGMTCASCVHSIEGMISQLEGVQQISVSLAKGTATVLYNPSVISPEELRAAIEDMGFEASVVSESCSTNPLGNHSAGNSMVQTTGGTPTSVQEVAPHAGRLSANHAPDILAKSPQSTRAVAPQKCFLQIKGMTCASCVSNIERNLQKEAGVLSVLVALMAGKAEVKYDPEVIQPLEIAQFIQDLGFEAAVMEDYTGSDGNIELTITGMTCASCVHNIESKLTRTNGITYASVALATSKALVKFDPEIIGPRDIIKIIEEIGFHASLAQRNPNAHHLDHKMEIKQWKKSFLCSLVFGIPVMALMIYMLIPSNEPHQSMVLDHNIIPGLSILNLIFFILCTFVQLLGGWYFYVQAYKSLRHGSANMDVLIVLATSIAYVYSLVILVVAVAEKAERSPVTFFDTPPMLFVFIALGRWLEHLAKSKTSEALAKLMSLQATEATVVTLGEDSLIIREEQVPMELVQRGDIVKVVPGGKFPVDGKVLEGNTMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLIKATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADRFSGYFVPFIIIMSTLTLVVWIVIGFIDFGVVQKYFPNPNKHISQTEVIIQFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITHGVPRVMRVLLLGDVATLPLRKFLAVVGTAEASSEHPLGVAVTKYCKEELGTETLGYCTDFQAVPGCGIGCKVSNVEGILAHSERPLSAPASHLNEAGSLPTEKDAAPQTFSVLIGNREWLRRNGLTISSDVSDAMTDHEMKGQTAILVAIDGVLCGMIAIADAVKQEAALAVHTLQSMGVDVVLITGDNRKTARAIATQVGINKVFAEVLPSHKVAKVQELQNKGKKVAMVGDGVNDSPALAQADMGVAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIHINLVLALIYNLVGIPIAAGVFMPIGIVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDLERYEAQAHGHMKPLTASQVSVHIGMDDRRRDSPRATPWDQVSYVSQVSLSSLTSDKPSRHSAAADDGGDKWSLLLNDRDEEQYI"

     misc_feature    902..1093
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(920..928,935..937)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1157..1345
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1175..1183,1190..1192)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1499..1675
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1517..1525,1532..1534)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1808..1996
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1823..1831,1838..1840)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2195..2383
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(2210..2218,2225..2227)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2420..2611
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(2438..2446,2453..2455)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2675..4783
                     /gene="ATP7B"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(3668..3670,3674..3676,4712..4714)
                     /gene="ATP7B"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(3800..3808,4010..4012,4163..4171,4259..4261,
                     4379..4387,4445..4447,4454..4456,4463..4465,4520..4522,
                     4529..4531)
                     /gene="ATP7B"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      

ccaaagcccgccgcccgttggaggccgttggctggcctttgcgcagcgcgcatcgattttgcagctgcggagttcactctcgccgcggttgcttcctttgggacccgcggcgcccggcagccaggcgcagagtccgaggagggggcagcgcagagtggacccgacgcggcgccaccgggcaccttccccgcaggcggtgggtgaaccctgggagcttgagtctgcggcccggctctgcgccgctcacctgccctcccgctcccgcaaacgcgtgagatcccagcacagtgtcggagcgcaccagcgctaggtggccgagaccgcggaggaggacgggcctccgtccggcggcgccggcacggcagaggacactgtggcaccggcggggccggcagttccagggcgggcacccccagccacctggggagtgggcgagggtccaaggcccactctcccctcgcgctttcatccccgcgcccccacgtcgggaggacggcggcgcgcacctttgaatcatccatgtagcgagggctgcggcttcccgggtctcaaatgaaggggcggttcctggacccctctttgctttagagccgagccgcgccaatgcctttacgctctgcgcctcctctccccggactttaacaccacgctgtcctccgccgaccaggtgacctttggctctgagccggatccgagaagaattcggtgtccgcgcgggacgatgcctgagcaggaaagacagatcacagccagagaaggggccagtcggaaaatcttatctaagctttctttgcctacccatgcctgggaaccagcaatgaagaagagttttgcttttgacaatgttggctacgaaggtggtctggatggcctgggccctttttctcaggtggccactagcacagtcaggatcttgggcatgacttgccagtcatgtgtgaagtccatcgaggacaggatttccaatttgaaaggcatcgtcagcatgaaggtttccctggaacaaggcagtgccactatgaaatatgtgccatcggttgtgagcctacaacaggtttgccatcaaattggggacatgggcttcgaggccagcattgcagaaggaaaggcagcctcctggccctcaaggtccttgcctgcccaggaggctgtggtcaagctccgggtggagggcatgacctgccagtcctgtgtcagctccattgaaggcaaggtccggaaactgcaaggagtagtgagagtcaaagtctcactcagcaaccaagaggctgtcatcacttatcagccttatctcattcagcccgaagacctcagggaccatgtaaatgacatgggatttgaagctgtcatcaagaacaaagtggctcccttaagcctgggaccaattgatattgagcggttacaaagcactaacccaaagagacctttatcttctgctaaccagaattttaataattctgagaccttggggcaccaaggaagccatgtggtcaccctccaactgagaatagatggaatgcactgtaagtcttgcgtcttgaatattgaagaaaatattggccagctcctaggggttcaaagtattcaagtgtccttggagaataaaactgcccaagtacagtatgacccttcttgtaccagcccagtggctctgcagagggctatcgaggcacttccacctgggaactttaaagtttctcttcctgatggagccgaagggagtgggacagatcacaggtcttccaattctcattcccctggttcctccccgagaaaccaggtccagggcacatgcagtaccactctgattgccattgccggcatgacctgtgcatcctgtgtccattccattgaaggcatgatctcccaactggaaggggtgcagcaaatatcggtgtctttggccaaagggactgcaacagttctttataatccctctgtaattagcccagaagaactcagagctgctatagaagacatgggatttgaggcttcagtcgtttctgaaagctgttctactaaccctcttggaaaccacagtgctgggaattccatggtgcaaactacaggtggtacacctacatctgtgcaggaagtggctccccacgctgggaggctctctgcaaaccatgccccggacatcttggcaaagtccccacaatcaaccagagcagtggcaccgcagaagtgtttcttacagatcaaaggcatgacctgtgcgtcctgtgtgtctaacatagaaaggaatctgcagaaagaagcaggtgttctctccgtgttggttgccttgatggcaggaaaggcagaggtcaagtatgacccagaagtcatccagccgcttgagatagctcagttcatccaggacctgggctttgaggcagcagtcatggaggactacacaggctccgatggcaacattgagctgacaatcacagggatgacctgcgcgtcctgtgtccacaacatagagtccaaactcacgaggacaaatggcatcacttatgcctccgttgcccttgccaccagcaaagcccttgttaagtttgacccggaaattatcggtccacgggatattatcaaaattattgaggaaattggctttcatgcttccctggcccagagaaaccccaacgctcatcacttggaccacaagatggaaataaagcagtggaagaagtctttcctgtgcagcctggtgtttggcatccctgtcatggccttaatgatctatatgctgatacccagcaatgagccccaccagtccatggtcctggaccacaacatcattccaggactatccattctaaatctcatcttctttatcttgtgtacctttgtccagctcctcggcgggtggtacttctacgttcaggcctacaaatctctgagacacgggtcagccaacatggatgtgctcattgtcctggccacgagcattgcttatgtctattctctggtcatcctggtggttgctgtggccgagaaggcggagaggagccctgtgacattcttcgacacaccccccatgctcttcgtgttcattgccctggggcggtggctggaacacttggcaaagagcaaaacctcagaagccctggccaaactcatgtctctccaagccacagaagccaccgttgtgacccttggtgaggacagtttaatcatcagggaggagcaagtccccatggagctggtgcagcggggcgatatcgtcaaggtggtccctgggggaaagtttccagtggacgggaaagtcctggaaggcaataccatggctgatgagtccctcatcacgggagaagccatgccagtcactaagaaacccggaagcactgtaattgcagggtctataaatgcacatggctctgtgctcattaaagccacccacgtgggcaatgacaccactttggctcagattgtgaaactggtggaagaggctcagatgtcaaaggcacccattcagcaactggctgaccggtttagtggatatttcgtcccatttatcatcatcatgtcaactttgacgctggtggtatggattgtaatcggttttatcgattttggtgttgttcagaaatactttcctaaccccaacaagcacatctcccagacagaggtgatcatccagtttgcgttccagacgtccatcacggtgctgtgcattgcctgcccctgctccctggggctggccacgcccacggccgtcatggtgggcaccggggtggccgcgcagaacggcatcctcatcaagggaggcaagccgctggagatggcgcacaagataaagactgtgatgtttgacaagactggcaccattacccatggcgtccccagggtcatgcgggtgctcctgctgggggacgtggccacactgcccctcaggaagtttctggctgtggtggggactgcggaggccagcagtgaacaccccttgggcgtggcagtcaccaaatactgtaaagaggaacttggaacagagaccttgggatactgcacggacttccaggcagtgccaggctgtggaattgggtgcaaagtcagcaacgtggaaggcatcctggcccacagtgagcgccctttgagtgcaccggccagtcacctgaatgaggctggcagccttcccacagaaaaagatgcagccccccagaccttctctgtgctgattggaaaccgtgagtggctgaggcgcaacggtttaaccatttctagcgacgtcagtgacgctatgacagaccacgagatgaaaggacagacggccatcctggtggctattgacggtgtgctctgtgggatgatcgctatcgcagacgctgtcaagcaggaggccgccctggctgtgcacacgctgcaaagcatgggtgtggacgtggttctgatcacgggagacaaccggaagacagccagagccattgccacccaggttggcatcaacaaagtctttgcagaggtgctgccttcgcacaaggtggctaaggtccaggagctccagaataaagggaagaaagtcgccatggtgggggatggggtcaatgactccccggccttggcccaggcagacatgggtgtcgccattggcaccggcacggatgtggccatcgaggcagccgacgtcgtccttatcagaaatgatttgctggatgtggtggctagcattcacctttccaagaggactgtccgaaggatacacatcaacctggtcctggcactgatttataacctggttgggatacccattgcagcaggtgtcttcatgcccatcggcattgtgctgcagccctggatgggctcagcagccatggcggcctcctctgtgtctgtggtgctctcatccctgcagctcaagtgctataagaagcctgacctggagaggtatgaggcacaggcgcatggccacatgaagcccctgacagcatcccaggtcagtgtgcacataggcatggatgacaggcggcgggactcccccagggccacaccatgggaccaggtcagctatgtcagccaggtgtcgctgtcctccctgacgtccgacaagccatctcggcacagcgctgcagcggatgatggtggggacaagtggtctctgctcctgaatgacagggatgaggagcagtacatctgacgacttcaggcggccaggccggggcagggacttgcctccactcaccacaagctgagcaggacagccagcagcaggatgggctgagctagcctccagctttggggacttccactccctggatatgtccagtcatcctgccctgcagcacacggccttgtctgggtgcagctgggcttggcctggagtggacggccctgcctccctcttggcctcacgggaccgtcagcatgggctttgtcttggactctagtccttggctggactgtagaaggtgagaggcgagtcacccttctcacagacctctgcttggagtatttaggatgactgctatgaaatggagaacagtttcatcaggaccaaaaaacctccctgggcctttccagagaactgcagacctcactgtcaggctctttctgatgacgcctgtctgtgtgcattgtgtttctgagaccacagtttacctcaggtttgcttgttgctttcttcctgcacagtctgttccttttctctcctgtgtgcttgtcagtggggacccctcgcaaccctgcctgtcacctgggagggtgggaccaatgtccttgtggtctttgctgctgctctcaggcgcttctccaatgctctggagtgtgcatttcagcctgaacctgcttcctggctcgcacatccccagccagggagcttgccacactcttcttcaagttgaggagagttcttttttgcttaaagcccacttctccatggagtggtggcttctcaatagtgttgttgctgaccagctggagtgagggtctcagagcctgacctgagagtccagactcagcttcctgtggggtctaggttctcacgattcaggacgtccttccatatgcctgcccagcctgtggtgctcgaaacatttgccccatgggagatgtatgtgtgcaggagcctccctgcacggcccaaggggcttcgttttcagtcttctgtgtgattgtcacctcgtggggttcagtagagaattacatcactagcgcctggccttgtgtggcttggaggaaatggtactgcccaaataggaggaaaacacagcctccctgagcctgcattctgcacgctgcccaggggcttcagaaaaggagtggccacagcaccccgaagggagcatctgtttacctggcagtggctctcagagcagcagaatgggtccagttttaagactctgaagttggttgtgattgacagaaccccttgggagcaaactagtagagttggattaaattctgggtgaaacccttttctcccacacaaaatagttttagtgatttttttcagtgtccattacttgccaggggcagttttagcagcacttttgatagattacatctaatcctcccaaccaaccagcaaggtagctattactgtccacattttacaggcaaggaaacaggctccaagaggctgaggactttgcccaggatgacatagccaatggacaagccgtgtctgtcagctgtgaaggcttcactctaattgtccttctaccttgaacagaagttttcctgataagaataaacaaggaaaaggtccttgcctcctggaagaacaaatctaccaggtgatctattcattgtttcaactcagaatgcacttgattcaggaggtcatctgaccttcaccttggatggttagtttcactttttacatatagtttttgcagggttttattttataagatccaagcatgccgttgattgtgttttcattgttttcagcacccccactccagcccgcagcacatttctgctattcgtcagtaattgtgccctctctttatgcttgcttggggaatgttgttttctggctaggctgatcattatctaaagaatctaattctgttgatttttaaaacttttaggaccataaacattgttttcatatgtggacatggaaatatttatataattttatagaaaataaccttttagatggtcaaagtgtaaggaatttttttgtcagataatcatttctacttcaaaaacatttcatgcaatattagaataaagttcctgtccttcctctaaaaa

//