2025-09-18 07:31:41, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS XM_030781092 4397 bp mRNA linear VRT 16-SEP-2019 DEFINITION PREDICTED: Chanos chanos ATPase copper transporting beta (atp7b), transcript variant X3, mRNA. ACCESSION XM_030781092 VERSION XM_030781092.1 DBLINK BioProject: PRJNA564626 KEYWORDS RefSeq. SOURCE Chanos chanos (milkfish) ORGANISM Chanos chanos Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Gonorynchiformes; Chanidae; Chanos. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_044502.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Chanos chanos Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..4397 /organism="Chanos chanos" /mol_type="mRNA" /db_xref="taxon:29144" /chromosome="8" gene 1..4397 /gene="atp7b" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 5 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:115817928" CDS 168..4304 /gene="atp7b" /codon_start=1 /product="copper-transporting ATPase 2 isoform X3" /protein_id="XP_030636952.1" /db_xref="GeneID:115817928" /translation="
MKKINTFTGFSNYASKPSSCGSSNGEQVCMVDCRRIAPNGSFDTPCRCGSELCTCRSEQDSTGGHRPNKSKENGGLPEGWLPQRHAFDNMAFEPGSPNELHPHSGHFSRATLSLSGLTSPSCVQAIHTRISALKGVASLSVSQASSLAWVDYHPSAVTSREICEQIKAMGYGVKDVAVTGETGVAESAVDEALVRIRVEGMTCQSCVRSIEGKMGTLAGVLGICVSLSDKEATVSFDCGKVQPEELRVCIEEMGFDAALMETTPLKSPQVANAAQDAMGGSREVTLGVEGMHCGSCVNNITKSVSDMLGVHSVLVSLENKSVNLKYDSSLITLDTVRGIVEGLPPGNFRVTLPGGTSELSRPLLRTGDPVNGQSSIPIQTVEIKILGMTCNSCVQSIEGMISQKPGVHSIKVSLKEEKGTVTYNPSLTSPEGIREAIDDMGFEASLQQGGPGSLENALTNEGSCDKKIFDLRYPSPPDTTPKSPTSSSAASGPASITPGPKEGNTQKCFIHVTGMTCASCVANIERNLLKHRGIKSVLVALMAGKAEVQYDPEVLDAAQVVQHISSLGFGASLMEENPAKDGILNLSVTGMTCASCVHNIETKLLRTRGILEASVALATNKAHVKFDTEELGPRDIIRIIEGLGFGASVIRHNGVGKRSGLDHQREIRQWKQSFLFSLVFGIPAMGLMIYMMVMDSLHKEHGGSMPMDQNLLPGLSLLNLAFFLLCTPVQIFGGRYFYIQAYRSLRHGVANMDVLIVLATTISYVYSCTILLVAMAERAKQSPVTFFDTPPMLFVFISLGRWLEHVAKSKTSEALAKLMSLQATDATIVTLGRDNSIISEEQVSVELVQRGDIVKVVPGGKFPVDGKVINGTSMADESLITGEPMPVKKKPGSCVIAGSINAHGALLVEATHVGADTTLSQIVRLVEEAQTSKAPIQQLADKLSGYFVPFIVIVSLITLVVWIVIGFLDFDVVVKYFPGYDENIPRTEVIVRFAFQASITVLSIACPCSLGLATPTAVMVGTGIGAQNGILIKGGEPLEMAHKIRTVMFDKTGTITNGVPRVTRVLVLWDQARLPLRTILAVVGTAEASSEHPLGIAVAKHCKEELGTESLGYCRDFQAVPGCGISCKVSNVEDLLQSTETTHTQAQTRLTLHGVTTDESSLTAEADTEPGGHVYSVLIGNRQWMRANGLHVTADVNEAMTSHESKGQTAILVAIDGVLCAMLAIADTVKAESALAVHTLRSMGIDVVMITGDNRRTAKAIATQVGIRKVFAEVLPSHKVAKVQELQARGLKVAMVGDGVNDSPALTRADLGIAISTGTDVAIEAADVVLIRQVCLCLWGWSSSHGWALQQWQLPLYQWWFHLCYCDCIRRRRQRCTR"
misc_feature 492..698 /gene="atp7b" /note="Copper chaperone CopZ [Inorganic ion transport and metabolism]; Region: CopZ; COG2608" /db_xref="CDD:442020" misc_feature 747..950 /gene="atp7b" /note="Copper chaperone CopZ [Inorganic ion transport and metabolism]; Region: CopZ; COG2608" /db_xref="CDD:442020" misc_feature 1014..1190 /gene="atp7b" /note="Copper chaperone CopZ [Inorganic ion transport and metabolism]; Region: CopZ; COG2608" /db_xref="CDD:442020" misc_feature 1311..1502 /gene="atp7b" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1329..1337,1344..1346) /gene="atp7b" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1701..1883 /gene="atp7b" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1710..1718,1725..1727) /gene="atp7b" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1923..2111 /gene="atp7b" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1938..1946,1953..1955) /gene="atp7b" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 2181..4163 /gene="atp7b" /note="P-type heavy metal-transporting ATPase, similar to human copper-transporting ATPases, ATP7A and ATP7B; Region: P-type_ATPase_Cu-like; cd02094" /db_xref="CDD:319783" misc_feature order(3315..3323,3525..3527,3702..3710,3798..3800, 3918..3926,3984..3986,3993..3995,4002..4004,4059..4061, 4068..4070) /gene="atp7b" /note="putative ATP binding site [chemical binding]; other site" /db_xref="CDD:319783" ORIGIN
tcctgtgctgggcgcaaaaccagcgactctttaaattaagtcggaccgactttttctatcggattgacagcagcatgacaggaagactcaacaacaaaatgtattttacgttgacggatgaaaagcagatgaaattgatcatgttagccttgagttaaagtgtcgcaatgaaaaaaatcaatacatttaccggtttctcaaattatgcgtccaagccgtcgagttgcggctcaagcaatggagagcaggtttgtatggtggattgtcggcgaatcgcaccgaacggttcgtttgacaccccgtgcaggtgtggatcggaactatgtacctgtcgctccgagcaagattccacgggcggacataggcctaataaatctaaggaaaatgggggtctccctgaaggatggctacctcagagacatgcctttgacaatatggcctttgagcctgggagcccaaatgagcttcacccccattcgggtcacttttcccgggcaacgctcagcctctctggcctaacctcaccttcttgcgtccaggccatccacacacggatatcagcgctgaagggagtagcctcactctctgtctctcaggccagtagcttagcttgggtggactatcacccttccgccgtcacgtccagggagatctgcgagcagatcaaggcgatggggtacggggtgaaggacgtagccgtgacaggggagaccggagtcgcggagtcagcggtggacgaggccctggttaggattagggtggagggaatgacgtgccaatcctgtgtgcgctccattgagggaaagatgggtacgctagctggggtgctgggaatctgtgtatcattatctgataaagaagcaactgtgtcctttgactgtgggaaagttcaaccagaggaactacgagtgtgtattgaagaaatgggattcgatgccgctctgatggagacgaccccactaaagagcccccaggttgcaaatgccgcacaggacgctatgggaggttcaagagaagtgaccttgggagtggaagggatgcattgtgggtcatgtgtaaataacatcacaaagagtgtgtctgacatgcttggggttcactctgtattggtctccctggaaaacaagagcgtgaatctcaaatacgacagttctcttattactttggatacagtcagaggcattgtggagggtcttccaccagggaattttcgggtgacccttcccggagggacatcagaactttctaggcctttgctcaggactggtgaccctgtgaatggtcaaagttccatcccaattcaaacagtcgagataaagattttaggaatgacttgtaactcctgtgtacaatccatagaagggatgatttcccagaagcccggggtgcattccataaaggtttctctgaaggaagagaagggaactgtcacatacaaccccagcctgaccagccctgaaggcataagagaggccattgatgatatgggctttgaagcatctcttcaacaaggtggtcctggatctttggagaatgcgttaacaaatgaggggtcatgtgataaaaagatatttgacctcaggtacccttccccacctgacaccacccccaagtccccaacgtcctctagtgcagcttctggtcctgcatccatcacccctggtccaaaggaagggaacacccaaaagtgcttcattcatgtgacaggcatgacatgtgcatcctgtgtggctaacattgagagaaacttactgaagcatagagggattaaatcggtcttggtagccctgatggccggtaaggcagaggtccagtatgacccagaggtcctggatgctgctcaggttgttcagcacatctccagtcttggttttggtgcgtcactgatggaggaaaatccggccaaagatgggattctgaatctttctgttactggtatgacttgcgcctcctgcgttcataacattgaaaccaaattactcagaaccagaggtattctagaagcctcagttgccctggcaaccaacaaagctcacgtgaagtttgacacagaggagcttgggccgcgggacatcatcagaataatcgagggacttggctttggggcatctgtgataagacacaacggtgtagggaaaaggagtggcttggatcaccaaagggagattcggcagtggaaacagtcctttttgttcagcctggtgtttggtatcccggcaatggggctaatgatctatatgatggtgatggacagtctccacaaagaacacggtggctccatgcctatggaccagaacctcttaccgggcctgtccctcctgaacctggccttcttcttgctctgcacccctgttcagattttcggcggccgttacttttatattcaagcatatcgttccctgaggcatggcgtggccaacatggatgtcttgatcgtcttggcaaccaccatttcctatgtctactcctgcaccatcctattggtggccatggccgaaagagcgaaacaaagccctgtcaccttcttcgacacgccgccgatgctgttcgttttcatttctctcggccgatggttggagcacgttgctaagagcaaaacatcagaggctctagccaaactcatgtccctgcaggcaacagacgccaccatagtcacgctgggccgggataactccatcatcagtgaggagcaggtctcggtggagctggtccagagaggggacatagtgaaggttgtgcctgggggaaagttccctgtggacgggaaggtgattaatgggacatccatggcagacgagtccctcatcactggagaaccgatgccggtcaagaaaaaaccaggcagctgtgtgatcgctggctccatcaatgcccacggggccctgctggtggaggccacacacgtaggggcagacaccaccctcagccagatagtccgactggtcgaggaggctcagacctcgaaggcgccgatccagcagctggcggacaagcttagtggctacttcgtccccttcattgtcatcgtctccctgataacgctggtggtctggatcgtcatcggctttctggacttcgacgtcgtggtcaagtactttcccggttacgacgagaacatcccgcggacggaagtgatcgtgcggttcgccttccaggcttccatcaccgtgctgtccatagcctgcccctgttcgctgggcctggccacgcccactgccgttatggtcggaaccggcataggagctcagaatggcatcctcatcaaaggcggagaacccctggagatggcccataagatccgtacggtaatgtttgataagaccggcaccatcactaacggggtcccgcgcgtgacccgggtgctggtactgtgggatcaggcacgactgcccctccgtaccatcctggcggtggtgggcacagctgaggccagcagcgagcatcctttgggtatagctgtcgctaaacactgcaaagaggagctggggacagagtctcttggatactgtcgtgacttccaggcagttccgggctgcgggatcagctgtaaagtgtctaatgtagaggacttactgcagtctactgagaccacacacacacaggcccagactcgtttgactctgcacggagtcacaacggacgagagcagcctcactgccgaagcagatactgaaccgggtggtcacgtgtattcagtgctgattggaaacaggcagtggatgagagctaatgggctccacgtcacagctgatgttaacgaagccatgaccagtcacgagagcaagggacagaccgccattctagtagccatagatggcgtgctgtgtgccatgctggccatagctgacaccgtgaaggctgaatcagccctggccgtgcacacgcttcgcagtatgggtatcgatgtggtcatgattacaggggataacagacgcacagccaaagccattgctacacaggtggggattagaaaagtctttgcggaggtcttgccctcacataaagtggcaaaggtacaggagctccaggcgaggggtctgaaggttgccatggtgggcgacggggtaaacgattcgcccgccctcacccgggctgacctgggcatcgccatcagcacgggcaccgacgtggccatcgaggcagctgacgtggttcttattaggcaggtttgtttatgcctgtggggttggtcctccagccatggatgggctctgcagcaatggcagcttcctctgtatcagtggtggtttcatctctgctactgcgactgtataagaagacggcggcagaggtgtacgagatgagagcgcagggtcgtatgcagagtctcacctcgtctcaggtgagcacccgcgtgggcctggaggagcgtcgccgtagcccccaggccgctcgcg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]