GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-03-29 21:52:10, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_030781092            4397 bp    mRNA    linear   VRT 16-SEP-2019
DEFINITION  PREDICTED: Chanos chanos ATPase copper transporting beta (atp7b),
            transcript variant X3, mRNA.
ACCESSION   XM_030781092
VERSION     XM_030781092.1
DBLINK      BioProject: PRJNA564626
KEYWORDS    RefSeq.
SOURCE      Chanos chanos (milkfish)
  ORGANISM  Chanos chanos
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Gonorynchiformes; Chanidae; Chanos.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_044502.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Chanos chanos Annotation Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4397
                     /organism="Chanos chanos"
                     /mol_type="mRNA"
                     /db_xref="taxon:29144"
                     /chromosome="8"
     gene            1..4397
                     /gene="atp7b"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 5 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 1 sample with support for all annotated introns"
                     /db_xref="GeneID:115817928"
     CDS             168..4304
                     /gene="atp7b"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X3"
                     /protein_id="XP_030636952.1"
                     /db_xref="GeneID:115817928"
                     /translation="
MKKINTFTGFSNYASKPSSCGSSNGEQVCMVDCRRIAPNGSFDTPCRCGSELCTCRSEQDSTGGHRPNKSKENGGLPEGWLPQRHAFDNMAFEPGSPNELHPHSGHFSRATLSLSGLTSPSCVQAIHTRISALKGVASLSVSQASSLAWVDYHPSAVTSREICEQIKAMGYGVKDVAVTGETGVAESAVDEALVRIRVEGMTCQSCVRSIEGKMGTLAGVLGICVSLSDKEATVSFDCGKVQPEELRVCIEEMGFDAALMETTPLKSPQVANAAQDAMGGSREVTLGVEGMHCGSCVNNITKSVSDMLGVHSVLVSLENKSVNLKYDSSLITLDTVRGIVEGLPPGNFRVTLPGGTSELSRPLLRTGDPVNGQSSIPIQTVEIKILGMTCNSCVQSIEGMISQKPGVHSIKVSLKEEKGTVTYNPSLTSPEGIREAIDDMGFEASLQQGGPGSLENALTNEGSCDKKIFDLRYPSPPDTTPKSPTSSSAASGPASITPGPKEGNTQKCFIHVTGMTCASCVANIERNLLKHRGIKSVLVALMAGKAEVQYDPEVLDAAQVVQHISSLGFGASLMEENPAKDGILNLSVTGMTCASCVHNIETKLLRTRGILEASVALATNKAHVKFDTEELGPRDIIRIIEGLGFGASVIRHNGVGKRSGLDHQREIRQWKQSFLFSLVFGIPAMGLMIYMMVMDSLHKEHGGSMPMDQNLLPGLSLLNLAFFLLCTPVQIFGGRYFYIQAYRSLRHGVANMDVLIVLATTISYVYSCTILLVAMAERAKQSPVTFFDTPPMLFVFISLGRWLEHVAKSKTSEALAKLMSLQATDATIVTLGRDNSIISEEQVSVELVQRGDIVKVVPGGKFPVDGKVINGTSMADESLITGEPMPVKKKPGSCVIAGSINAHGALLVEATHVGADTTLSQIVRLVEEAQTSKAPIQQLADKLSGYFVPFIVIVSLITLVVWIVIGFLDFDVVVKYFPGYDENIPRTEVIVRFAFQASITVLSIACPCSLGLATPTAVMVGTGIGAQNGILIKGGEPLEMAHKIRTVMFDKTGTITNGVPRVTRVLVLWDQARLPLRTILAVVGTAEASSEHPLGIAVAKHCKEELGTESLGYCRDFQAVPGCGISCKVSNVEDLLQSTETTHTQAQTRLTLHGVTTDESSLTAEADTEPGGHVYSVLIGNRQWMRANGLHVTADVNEAMTSHESKGQTAILVAIDGVLCAMLAIADTVKAESALAVHTLRSMGIDVVMITGDNRRTAKAIATQVGIRKVFAEVLPSHKVAKVQELQARGLKVAMVGDGVNDSPALTRADLGIAISTGTDVAIEAADVVLIRQVCLCLWGWSSSHGWALQQWQLPLYQWWFHLCYCDCIRRRRQRCTR"
     misc_feature    498..689
                     /gene="atp7b"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(516..524,531..533)
                     /gene="atp7b"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    753..941
                     /gene="atp7b"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(768..776,783..785)
                     /gene="atp7b"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1014..1190
                     /gene="atp7b"
                     /note="copper chaperone CopZ; Region: chaper_CopZ_Bs;
                     NF033795"
                     /db_xref="CDD:411375"
     misc_feature    1311..1502
                     /gene="atp7b"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1329..1337,1344..1346)
                     /gene="atp7b"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1701..1883
                     /gene="atp7b"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1710..1718,1725..1727)
                     /gene="atp7b"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1923..2111
                     /gene="atp7b"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1938..1946,1953..1955)
                     /gene="atp7b"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2181..4163
                     /gene="atp7b"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(3315..3323,3525..3527,3702..3710,3798..3800,
                     3918..3926,3984..3986,3993..3995,4002..4004,4059..4061,
                     4068..4070)
                     /gene="atp7b"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      
tcctgtgctgggcgcaaaaccagcgactctttaaattaagtcggaccgactttttctatcggattgacagcagcatgacaggaagactcaacaacaaaatgtattttacgttgacggatgaaaagcagatgaaattgatcatgttagccttgagttaaagtgtcgcaatgaaaaaaatcaatacatttaccggtttctcaaattatgcgtccaagccgtcgagttgcggctcaagcaatggagagcaggtttgtatggtggattgtcggcgaatcgcaccgaacggttcgtttgacaccccgtgcaggtgtggatcggaactatgtacctgtcgctccgagcaagattccacgggcggacataggcctaataaatctaaggaaaatgggggtctccctgaaggatggctacctcagagacatgcctttgacaatatggcctttgagcctgggagcccaaatgagcttcacccccattcgggtcacttttcccgggcaacgctcagcctctctggcctaacctcaccttcttgcgtccaggccatccacacacggatatcagcgctgaagggagtagcctcactctctgtctctcaggccagtagcttagcttgggtggactatcacccttccgccgtcacgtccagggagatctgcgagcagatcaaggcgatggggtacggggtgaaggacgtagccgtgacaggggagaccggagtcgcggagtcagcggtggacgaggccctggttaggattagggtggagggaatgacgtgccaatcctgtgtgcgctccattgagggaaagatgggtacgctagctggggtgctgggaatctgtgtatcattatctgataaagaagcaactgtgtcctttgactgtgggaaagttcaaccagaggaactacgagtgtgtattgaagaaatgggattcgatgccgctctgatggagacgaccccactaaagagcccccaggttgcaaatgccgcacaggacgctatgggaggttcaagagaagtgaccttgggagtggaagggatgcattgtgggtcatgtgtaaataacatcacaaagagtgtgtctgacatgcttggggttcactctgtattggtctccctggaaaacaagagcgtgaatctcaaatacgacagttctcttattactttggatacagtcagaggcattgtggagggtcttccaccagggaattttcgggtgacccttcccggagggacatcagaactttctaggcctttgctcaggactggtgaccctgtgaatggtcaaagttccatcccaattcaaacagtcgagataaagattttaggaatgacttgtaactcctgtgtacaatccatagaagggatgatttcccagaagcccggggtgcattccataaaggtttctctgaaggaagagaagggaactgtcacatacaaccccagcctgaccagccctgaaggcataagagaggccattgatgatatgggctttgaagcatctcttcaacaaggtggtcctggatctttggagaatgcgttaacaaatgaggggtcatgtgataaaaagatatttgacctcaggtacccttccccacctgacaccacccccaagtccccaacgtcctctagtgcagcttctggtcctgcatccatcacccctggtccaaaggaagggaacacccaaaagtgcttcattcatgtgacaggcatgacatgtgcatcctgtgtggctaacattgagagaaacttactgaagcatagagggattaaatcggtcttggtagccctgatggccggtaaggcagaggtccagtatgacccagaggtcctggatgctgctcaggttgttcagcacatctccagtcttggttttggtgcgtcactgatggaggaaaatccggccaaagatgggattctgaatctttctgttactggtatgacttgcgcctcctgcgttcataacattgaaaccaaattactcagaaccagaggtattctagaagcctcagttgccctggcaaccaacaaagctcacgtgaagtttgacacagaggagcttgggccgcgggacatcatcagaataatcgagggacttggctttggggcatctgtgataagacacaacggtgtagggaaaaggagtggcttggatcaccaaagggagattcggcagtggaaacagtcctttttgttcagcctggtgtttggtatcccggcaatggggctaatgatctatatgatggtgatggacagtctccacaaagaacacggtggctccatgcctatggaccagaacctcttaccgggcctgtccctcctgaacctggccttcttcttgctctgcacccctgttcagattttcggcggccgttacttttatattcaagcatatcgttccctgaggcatggcgtggccaacatggatgtcttgatcgtcttggcaaccaccatttcctatgtctactcctgcaccatcctattggtggccatggccgaaagagcgaaacaaagccctgtcaccttcttcgacacgccgccgatgctgttcgttttcatttctctcggccgatggttggagcacgttgctaagagcaaaacatcagaggctctagccaaactcatgtccctgcaggcaacagacgccaccatagtcacgctgggccgggataactccatcatcagtgaggagcaggtctcggtggagctggtccagagaggggacatagtgaaggttgtgcctgggggaaagttccctgtggacgggaaggtgattaatgggacatccatggcagacgagtccctcatcactggagaaccgatgccggtcaagaaaaaaccaggcagctgtgtgatcgctggctccatcaatgcccacggggccctgctggtggaggccacacacgtaggggcagacaccaccctcagccagatagtccgactggtcgaggaggctcagacctcgaaggcgccgatccagcagctggcggacaagcttagtggctacttcgtccccttcattgtcatcgtctccctgataacgctggtggtctggatcgtcatcggctttctggacttcgacgtcgtggtcaagtactttcccggttacgacgagaacatcccgcggacggaagtgatcgtgcggttcgccttccaggcttccatcaccgtgctgtccatagcctgcccctgttcgctgggcctggccacgcccactgccgttatggtcggaaccggcataggagctcagaatggcatcctcatcaaaggcggagaacccctggagatggcccataagatccgtacggtaatgtttgataagaccggcaccatcactaacggggtcccgcgcgtgacccgggtgctggtactgtgggatcaggcacgactgcccctccgtaccatcctggcggtggtgggcacagctgaggccagcagcgagcatcctttgggtatagctgtcgctaaacactgcaaagaggagctggggacagagtctcttggatactgtcgtgacttccaggcagttccgggctgcgggatcagctgtaaagtgtctaatgtagaggacttactgcagtctactgagaccacacacacacaggcccagactcgtttgactctgcacggagtcacaacggacgagagcagcctcactgccgaagcagatactgaaccgggtggtcacgtgtattcagtgctgattggaaacaggcagtggatgagagctaatgggctccacgtcacagctgatgttaacgaagccatgaccagtcacgagagcaagggacagaccgccattctagtagccatagatggcgtgctgtgtgccatgctggccatagctgacaccgtgaaggctgaatcagccctggccgtgcacacgcttcgcagtatgggtatcgatgtggtcatgattacaggggataacagacgcacagccaaagccattgctacacaggtggggattagaaaagtctttgcggaggtcttgccctcacataaagtggcaaaggtacaggagctccaggcgaggggtctgaaggttgccatggtgggcgacggggtaaacgattcgcccgccctcacccgggctgacctgggcatcgccatcagcacgggcaccgacgtggccatcgaggcagctgacgtggttcttattaggcaggtttgtttatgcctgtggggttggtcctccagccatggatgggctctgcagcaatggcagcttcctctgtatcagtggtggtttcatctctgctactgcgactgtataagaagacggcggcagaggtgtacgagatgagagcgcagggtcgtatgcagagtctcacctcgtctcaggtgagcacccgcgtgggcctggaggagcgtcgccgtagcccccaggccgctcgcg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]