ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2025-10-30 23:57:08, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS XM_030564309 6386 bp mRNA linear VRT 24-AUG-2019
DEFINITION PREDICTED: Gopherus evgoodei ATPase copper transporting beta
(ATP7B), transcript variant X4, mRNA.
ACCESSION XM_030564309
VERSION XM_030564309.1
DBLINK BioProject: PRJNA559383
KEYWORDS RefSeq.
SOURCE Gopherus evgoodei (Goodes thornscrub tortoise)
ORGANISM Gopherus evgoodei
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Archelosauria; Testudinata; Testudines; Cryptodira; Durocryptodira;
Testudinoidea; Testudinidae; Gopherus.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NC_044322.1) annotated using gene prediction method: Gnomon.
Also see:
Documentation of NCBI's Annotation Process
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI
Annotation Status :: Full annotation
Annotation Name :: Gopherus evgoodei Annotation Release
100
Annotation Version :: 100
Annotation Pipeline :: NCBI eukaryotic genome annotation
pipeline
Annotation Software Version :: 8.2
Annotation Method :: Best-placed RefSeq; Gnomon
Features Annotated :: Gene; mRNA; CDS; ncRNA
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..6386
/organism="Gopherus evgoodei"
/mol_type="mRNA"
/db_xref="taxon:1825980"
/chromosome="1"
/sex="male"
/tissue_type="whole blood"
/ecotype="Sinaloan lineage"
/geo_loc_name="Mexico: Sonora"
/collection_date="2010-08-10"
/collected_by="T. Edwards"
gene 1..6386
/gene="ATP7B"
/note="Derived by automated computational analysis using
gene prediction method: Gnomon. Supporting evidence
includes similarity to: 25 Proteins, and 100% coverage of
the annotated genomic feature by RNAseq alignments,
including 1 sample with support for all annotated introns"
/db_xref="GeneID:115652357"
CDS 59..4687
/gene="ATP7B"
/codon_start=1
/product="copper-transporting ATPase 2 isoform X4"
/protein_id="XP_030420169.1"
/db_xref="GeneID:115652357"
/translation="
MERESDSDLKRDQSTLATLNNKNVTLVTFHKRQSSNAVPALLIVSEPSKSGSPGKAGDCSQKEEKVSQSYSVGASEVNSMNALSKSSSPATCVQEPTMKQNFAFDNIGYERSAENMPSLLPQTSTITVNILGMTCQSCVQSIEGRISKVKGIVSIKVSLEQSNAVIKYIQSEISPQEVCQEIGDMGFDASIAEARTTASSVRSTSLGEALMKLRVEGMTCQSCVNTIEGKIGKLHGVLRIKVSLSNQEAVIAYQPYIIQPEDLKKHIDNMGYESTIKSKQAPLKLGMIDLERLQTTCTKKTLATLNNSSVEPVVGKMNSTTTMKLGVEGMHCKSCVKNIEGNISGLPGVQSISVSLEHKNAVVQFNPNLITPVSLQQAIEALPPGNFKVSLPNGVEANNGELLSKAAFSSPQFHSRSSGDQLTSTSVLHIDGMTCGSCVQSIEGTMSQRKGVQHISVSLAERTGIIHYNSAVTNSEELRGAIEDMGFDASILTDTTTWKYMNQPLFRNAAIQPNAWESAAQRTENVSESSHQGYLSDVQPKNSYLGNPKPPSVATTEKCFMQITGMTCASCVSNIERNLQKEDGIVSVLVALMAGKAEIKYKPESIQPLEIVQLIQNLGFNAAVIEDHTATDGNAELIITGMTCASCVHNIESKLTRTNGIFYASVALATSKAHIQFDPEIIGPRDIIQIIEGIGFHASVAKRDPNAHNLDHKKEIKQWRKSFLCSLVFGIPVLILMIYMLIPDGLQHDTVVLEQNLIPGLSILNLLFFVLCTLVQFLGGWYFYVQAYKSLKHKTANMDVLIVLATTIAYIYSCVILMVAIAEKAEKSPITFFDTPPMLFVFISLGRWLEHIAKSKTSEALAKLMSLQATEAIIVTLGPDHSIIREEQVAVELVQRGDIIKVVPGGKFPVDGKVIEGSSMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVNATHVGSDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISAVTLLVWITIGFINFDVVQKYFPHQNKHLSKAEVILRFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITCGVPKVMRMLLLRDTAKLSLKKVLAIVGTAEASSEHPLGMAVTKYCKEELGTESLGYCTDFQAVPGCGISCKVRSVEAVLGQSEQSVNEQNAYLSSVSTISLGHSSSIMVSESDGAAAPLTYSVLIGNREWMRRNGLLISSDVNDAMTGHEMKGQTAILVAIDGALYGMIVIADTVKQEAALAVHTLQNMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNKGKKVAMVGDGVNDSPALAGADIGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLVLALIYNLLGIPIAAGVFMPIGIVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPGTERYEAKAQGHMKPLTPSQISVHIGMDDRRRDSPRLTAWDQISQVSLSSLTSNKLPGHGGFREEEDGKWSLLTNDRDEEQYI"
misc_feature 437..628
/gene="ATP7B"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(455..463,470..472)
/gene="ATP7B"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 692..883
/gene="ATP7B"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(710..718,725..727)
/gene="ATP7B"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 1037..1204
/gene="ATP7B"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(1046..1054,1061..1063)
/gene="ATP7B"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 1325..1525
/gene="ATP7B"
/note="Copper chaperone CopZ [Inorganic ion transport and
metabolism]; Region: CopZ; COG2608"
/db_xref="CDD:442020"
misc_feature 1739..1927
/gene="ATP7B"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(1754..1762,1769..1771)
/gene="ATP7B"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 1964..2155
/gene="ATP7B"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(1982..1990,1997..1999)
/gene="ATP7B"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 2219..4360
/gene="ATP7B"
/note="P-type heavy metal-transporting ATPase, similar to
human copper-transporting ATPases, ATP7A and ATP7B;
Region: P-type_ATPase_Cu-like; cd02094"
/db_xref="CDD:319783"
misc_feature order(3212..3214,3218..3220,4289..4291)
/gene="ATP7B"
/note="putative Cu binding site [ion binding]; other site"
/db_xref="CDD:319783"
misc_feature order(3344..3352,3554..3556,3740..3748,3836..3838,
3956..3964,4022..4024,4031..4033,4040..4042,4097..4099,
4106..4108)
/gene="ATP7B"
/note="putative ATP binding site [chemical binding]; other
site"
/db_xref="CDD:319783"
ORIGIN
aataacatgtcttaaaaattcccatttggcgttacaatacttgaagcctggagagataatggagagggaatcagacagtgatttgaaaagggaccagtccaccctggctactttaaacaacaaaaatgtaactctggtgacttttcataagcggcaatcatctaatgctgtgcctgcactactgattgtcagtgaaccttccaagtcaggatctcctggaaaagcaggggactgctctcagaaagaagagaaagtttcacagagttactcggtgggagcatcagaagtcaacagcatgaatgctttgtctaagtctagctcccctgctacttgtgtacaggaaccaaccatgaagcagaattttgcttttgacaacatcggctacgagaggagcgctgaaaatatgccctctctgcttcctcaaacgagcaccatcacagtcaatattttgggtatgacctgccagtcttgtgtgcagtcgatagagggcagaatttccaaggttaagggcattgtgagcatcaaggtctcccttgagcagagcaatgctgtaataaaatatatacagtcagaaataagcccccaagaggtttgccaggaaattggagacatgggctttgatgccagcattgcagaagcaagaactacagcatcatctgtaagatcgacgtccttgggcgaagcactaatgaagctgcgagtagaaggtatgacatgccaatcttgtgtcaacaccattgaaggaaagattggaaaactacatggcgtgctgagaatcaaagtctccctcagtaaccaagaagcagtcattgcttaccagccttacatcattcaacctgaagacctcaaaaaacacattgataacatggggtatgaaagcacaattaagagcaagcaagccccattaaagcttggtatgattgatctagaacgcttgcagactacatgcacaaagaaaactctagccaccttgaacaatagcagtgtggagccagtggtgggcaaaatgaatagtacaactactatgaaactgggagtagaagggatgcactgcaagtcttgcgtcaaaaacatcgaaggaaatatatcaggtcttccaggcgtacaaagtattagtgtgtcattggaacataaaaatgctgttgtgcaatttaacccaaacctaattaccccagtatctttgcaacaagccattgaggcccttccacctggtaactttaaagtctccctccctaatggagtggaagcaaataacggagagcttttatcaaaggcagcattttcatcacctcagtttcatagcagatcctctggggatcagctgacaagcacatctgtacttcatattgatggaatgacctgtgggtcctgtgtacagtccatagaaggcacaatgtcccaaaggaaaggggtacaacatatatcagtttcattagctgaaaggactggaatcatacactacaattcagctgtaactaattcagaagagctaagaggtgctatagaagacatgggatttgatgcttccattctcacagataccaccacttggaaatatatgaatcaacctcttttcaggaacgctgcaattcagcctaatgcttgggagtcagctgcccagagaacagaaaatgtttctgagtcttctcatcaaggctacttgtccgatgtccagccaaagaattcttacctcggtaatccaaagccacccagtgtagcgacaacagaaaagtgctttatgcagatcacaggcatgacctgcgcatcatgtgtgtcaaacattgaaagaaatctgcaaaaagaagacggtatcgtttcagtgctagtagcactgatggcaggaaaagcggagataaaatacaagccagagagcattcagcctcttgaaatagtacagctgatccaaaacttgggcttcaatgctgcagtcatagaagatcatactgctacagatggcaatgcagagctcattattacagggatgacttgtgcttcctgtgttcacaatattgaatccaaactaaccagaactaatggcatcttctatgcctcagtagcgcttgctaccagcaaagctcacatccagtttgatcctgaaatcattggacctcgagatattatacaaattattgagggaattggttttcatgcttccgtggccaagagagaccctaatgctcataacttggatcacaaaaaggaaataaaacaatggagaaaatctttcttgtgcagcctagtgtttggaatccctgtcttaatcttaatgatttatatgctaatacctgatggcctacagcacgacactgtggtgctggaacaaaatctaattcctggattatctattttaaatcttctcttctttgtcttgtgcactttggttcagttcctcggtggatggtacttttatgtccaagcctacaaatcactgaagcacaaaacagccaatatggatgtacttattgtactggccacaactattgcttatatatactcttgtgtgatcttgatggtggctatagctgaaaaggcagagaaaagccccatcacattctttgacacaccacctatgttattcgtattcatttcccttgggagatggttggaacacatagcaaagagtaaaacatcagaagcacttgctaaactaatgtctctccaagctactgaagctatcatagtgactcttggacctgaccactccatcatcagggaggagcaggtggctgttgaattggttcagcggggtgacattataaaagttgtccctggtgggaagttcccagttgatggaaaagtcattgaaggcagctctatggcagatgaatcgctcattactggggaagccatgccagttactaaaaaacctgggagcacagtgattgcaggttctataaatgcacatggctcagttcttgttaatgcaactcatgttgggtctgacaccaccctggcacaaattgtgaaattggtagaagaagctcagatgtcaaaggcacccatccagcaattggctgataagtttagtggatattttgttccatttatcatcatcatttcagcagtgacattgttagtgtggatcacaattggttttataaactttgatgttgttcagaaatactttcctcatcagaacaaacacctctcaaaagctgaagtaatactgaggtttgcatttcaaacttcaatcactgtgctgtgcattgcatgcccctgttccttgggcttggctactccaacagctgtgatggtgggcacaggagttgctgctcagaatggtattctcatcaaaggtggaaaacctctggaaatggcccacaagataaagactgtgatgtttgataaaaccgggaccatcacctgtggcgttcctaaagtcatgaggatgctcttgctaagggacacagctaagctgtctctaaagaaggtacttgcaattgtcggcactgcagaagccagcagtgagcatcccttaggaatggctgtcactaaatactgtaaagaggaacttggcacggagagcctgggatactgcacagattttcaggcagtcccgggctgtggaatcagctgtaaagtccgcagcgtggaagctgtactgggccagagtgagcagagtgtgaatgagcagaatgcttacctaagcagtgtcagcacgatttctctgggacacagttcatcaatcatggtctctgaatctgatggtgcagcagcccctctgacatactcagttctgattggaaatcgtgaatggatgagacgcaacggcttgcttatatccagtgatgttaatgatgcaatgacaggccatgaaatgaaaggacagacagccatattggtggctatagatggtgcgttgtatggaatgatcgtgatagctgataccgtcaaacaggaggcagcgctcgctgtgcacaccctgcaaaatatgggaatagacgtggtgctaataacgggggacaacagaaaaactgcaaaagcaattgccactcaggttggcatcaaaaaggtctttgctgaggttctgccctctcacaaagtcgcgaaggttcaggaactccagaataaagggaagaaggttgccatggttggagatggagtcaacgattccccggcattggctggagcggacattggcattgctattggaacaggcacggatgttgccattgaagctgcagatgtcgttcttattcgaaatgacttattggatgtggtggctagtattcatctatcaaagaggacagtaagaagaatacgaataaatctggtccttgccttaatttataatctgcttgggatacctatagcggcaggagtgttcatgcctattggaattgtgctgcagccctggatggggtcagcagcaatggcagcttcttcagtatctgtggtgctatcttccctgcaactgaaatgttacaagaagccaggaactgaaaggtatgaagcaaaagctcaaggccacatgaagccactgactccttcccaaatcagtgttcacattgggatggatgacaggagacgggattcacccaggctaactgcctgggatcagatcagtcaagtgtctctctcttctctgacttcaaacaagctgccaggacatggcggttttagagaggaagaagatggcaagtggtcactgctcacgaatgacagagatgaagaacagtacatttaaatgctacatcctatcgctgaacatgaagtcactgagacttttcaccattggcagtgatgaccaaaagacccacagaagtataaatgcagccctgatgttccaatttgcaaagcagctcagaaattcagcattagattgtgtgaattatgatttgtcagttcacaaataatttccaggcattgaaaaagcttgaggccctgcaaggaattatgccctttacttcttgcacagtgtgaagttggagtccacaaaacctaacatgactcctatgttgtagatcaattactgagaatcaaaatcacaggctgtccagtcttagtgactctcttgtgcttctttatggaacttccgtgaaaagattttaaattaaatctgccaaattcattttctaggtcaaagtgaaaaccagtacaccggacatgaaatagctctatatttaaggatcatatttttacatagaatcaaatctagtcatctcaacatgggaaaattttatatttagggctcacacaacgtgtgttttattagcacaaaaatatataaattgtatattttgctgtgcataaaacttgtaaaattctgtttcaaaggtgattatgtatcttatagcatcactaattttattttatgaaacatctcaatttgccaaacttgcttgctgcgtccaactactcctcttaggttttccagttttctcctgcatgttcttcagagccctttcttcctattagagttccacctttagacatctgttatgtcttcagattttcccgtatgggatgagatcctgcaaggcactggggaccctgcaattcctgttgaaattcacaacatttgagctcctttcagtgttttactggttcaggatagttcaccattttgtagaatcttttgttgcacctgataactgcagcattcagctgtttctttgatgttcagagtggtgtaaatggtgccagtgtaagctgtcctggtggctcagttattggtatgttcatgctaatacactgagattctttccgacttggagcatttgttcttggtcctgatgggagctagaatgttagaagtgacatcctcagtctctgtgttggtggattagctaacagtgctcttcaaggactctatggaagttgtggggaaacctcaaaagctaagattcaccggagaggtggggtttgggaggcttttctgtgcaaatggcaggtgagaaagaagtagcaggttaaagcccatctatccactcaaaaatctattctactcaaaatccctcttgatatcttgtgttagaactgggtggttaaaagaaagtcccatgcctgaatactcaccctatccccttaaaagggactcttcatctctgagttttatcttggaccataaacactacagccaatgcttaaaaattgccattaggaggcaacaataattatattggtgtaacagagaacagagcgtgaccaagtgttcatgggattccagagtagctggagggggtaaggagaaagggtttgagattacagtactgtttaaataacaccagataacacagcttgttggtcatttaaaataaaagtgtaaactgattaaaaatggaaataatagcgcatggccaccaggttcttatttattctcgtatgaatcactttagcaatgctagctgtttgtcatttaatcctgtcctggtttacaacctgtg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]