2025-07-08 14:54:04, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS XM_030564308 4354 bp mRNA linear VRT 24-AUG-2019 DEFINITION PREDICTED: Gopherus evgoodei ATPase copper transporting beta (ATP7B), transcript variant X3, mRNA. ACCESSION XM_030564308 VERSION XM_030564308.1 DBLINK BioProject: PRJNA559383 KEYWORDS RefSeq. SOURCE Gopherus evgoodei (Goodes thornscrub tortoise) ORGANISM Gopherus evgoodei Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Testudinata; Testudines; Cryptodira; Durocryptodira; Testudinoidea; Testudinidae; Gopherus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_044322.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Gopherus evgoodei Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..4354 /organism="Gopherus evgoodei" /mol_type="mRNA" /db_xref="taxon:1825980" /chromosome="1" /sex="male" /tissue_type="whole blood" /ecotype="Sinaloan lineage" /geo_loc_name="Mexico: Sonora" /collection_date="2010-08-10" /collected_by="T. Edwards" gene 1..4354 /gene="ATP7B" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 18 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:115652357" CDS 63..4262 /gene="ATP7B" /codon_start=1 /product="copper-transporting ATPase 2 isoform X3" /protein_id="XP_030420168.1" /db_xref="GeneID:115652357" /translation="
MNALSKSSSPATCVQEPTMKQNFAFDNIGYERSAENMPSLLPQTSTITVNILGMTCQSCVQSIEGRISKVKGIVSIKVSLEQSNAVIKYIQSEISPQEVCQEIGDMGFDASIAEARTTASSVRSTSLGEALMKLRVEGMTCQSCVNTIEGKIGKLHGVLRIKVSLSNQEAVIAYQPYIIQPEDLKKHIDNMGYESTIKSKQAPLKLGMIDLERLQTTCTKKTLATLNNSSVEPVVGKMNSTTTMKLGVEGMHCKSCVKNIEGNISGLPGVQSISVSLEHKNAVVQFNPNLITPVSLQQAIEALPPGNFKVSLPNGVEANNGELLSKAAFSSPQFHSRSSGDQLTSTSVLHIDGMTCGSCVQSIEGTMSQRKGVQHISVSLAERTGIIHYNSAVTNSEELRGAIEDMGFDASILTDTTTWKYMNQPLFRNAAIQPNAWESAAQRTENVSESSHQGYLSDVQPKNSYLGNPKPPSVATTEKCFMQITGMTCASCVSNIERNLQKEDGIVSVLVALMAGKAEIKYKPESIQPLEIVQLIQNLGFNAAVIEDHTATDGNAELIITGMTCASCVHNIESKLTRTNGIFYASVALATSKAHIQFDPEIIGPRDIIQIIEGIGFHASVAKRDPNAHNLDHKKEIKQWRKSFLCSLVFGIPVLILMIYMLIPDGLQHDTVVLEQNLIPGLSILNLLFFVLCTLVQFLGGWYFYVQAYKSLKHKTANMDVLIVLATTIAYIYSCVILMVAIAEKAEKSPITFFDTPPMLFVFISLGRWLEHIAKSKTSEALAKLMSLQATEAIIVTLGPDHSIIREEQVAVELVQRGDIIKVVPGGKFPVDGKVIEGSSMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVNATHVGSDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISAVTLLVWITIGFINFDVVQKYFPHQNKHLSKAEVILRFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITCGVPKVMRMLLLRDTAKLSLKKVLAIVGTAEASSEHPLGMAVTKYCKEELGTESLGYCTDFQAVPGCGISCKVRSVEAVLGQSEQSVNEQNAYLSSVSTISLGHSSSIMVSESDGAAAPLTYSVLIGNREWMRRNGLLISSDVNDAMTGHEMKGQTAILVAIDGALYGMIVIADTVKQEAALAVHTLQNMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNKGKKVAMVGDGVNDSPALAGADIGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLVLALIYNLLGIPIAAASLPHKVPLGLSRVLLLRSVHAYWNCAAALDGVSSNGSFFSICGAIFPATEMLQEARN"
misc_feature 204..395 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(222..230,237..239) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 459..650 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(477..485,492..494) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 804..971 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(813..821,828..830) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1092..1292 /gene="ATP7B" /note="Copper chaperone CopZ [Inorganic ion transport and metabolism]; Region: CopZ; COG2608" /db_xref="CDD:442020" misc_feature 1506..1694 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1521..1529,1536..1538) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1731..1922 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1749..1757,1764..1766) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1986..4085 /gene="ATP7B" /note="P-type heavy metal-transporting ATPase, similar to human copper-transporting ATPases, ATP7A and ATP7B; Region: P-type_ATPase_Cu-like; cd02094" /db_xref="CDD:319783" misc_feature order(2979..2981,2985..2987,4056..4058) /gene="ATP7B" /note="putative Cu binding site [ion binding]; other site" /db_xref="CDD:319783" misc_feature order(3111..3119,3321..3323,3507..3515,3603..3605, 3723..3731,3789..3791,3798..3800,3807..3809,3864..3866, 3873..3875) /gene="ATP7B" /note="putative ATP binding site [chemical binding]; other site" /db_xref="CDD:319783" ORIGIN
gctctcagaaagaagagaaagtttcacagagttactcggtgggagcatcagaagtcaacagcatgaatgctttgtctaagtctagctcccctgctacttgtgtacaggaaccaaccatgaagcagaattttgcttttgacaacatcggctacgagaggagcgctgaaaatatgccctctctgcttcctcaaacgagcaccatcacagtcaatattttgggtatgacctgccagtcttgtgtgcagtcgatagagggcagaatttccaaggttaagggcattgtgagcatcaaggtctcccttgagcagagcaatgctgtaataaaatatatacagtcagaaataagcccccaagaggtttgccaggaaattggagacatgggctttgatgccagcattgcagaagcaagaactacagcatcatctgtaagatcgacgtccttgggcgaagcactaatgaagctgcgagtagaaggtatgacatgccaatcttgtgtcaacaccattgaaggaaagattggaaaactacatggcgtgctgagaatcaaagtctccctcagtaaccaagaagcagtcattgcttaccagccttacatcattcaacctgaagacctcaaaaaacacattgataacatggggtatgaaagcacaattaagagcaagcaagccccattaaagcttggtatgattgatctagaacgcttgcagactacatgcacaaagaaaactctagccaccttgaacaatagcagtgtggagccagtggtgggcaaaatgaatagtacaactactatgaaactgggagtagaagggatgcactgcaagtcttgcgtcaaaaacatcgaaggaaatatatcaggtcttccaggcgtacaaagtattagtgtgtcattggaacataaaaatgctgttgtgcaatttaacccaaacctaattaccccagtatctttgcaacaagccattgaggcccttccacctggtaactttaaagtctccctccctaatggagtggaagcaaataacggagagcttttatcaaaggcagcattttcatcacctcagtttcatagcagatcctctggggatcagctgacaagcacatctgtacttcatattgatggaatgacctgtgggtcctgtgtacagtccatagaaggcacaatgtcccaaaggaaaggggtacaacatatatcagtttcattagctgaaaggactggaatcatacactacaattcagctgtaactaattcagaagagctaagaggtgctatagaagacatgggatttgatgcttccattctcacagataccaccacttggaaatatatgaatcaacctcttttcaggaacgctgcaattcagcctaatgcttgggagtcagctgcccagagaacagaaaatgtttctgagtcttctcatcaaggctacttgtccgatgtccagccaaagaattcttacctcggtaatccaaagccacccagtgtagcgacaacagaaaagtgctttatgcagatcacaggcatgacctgcgcatcatgtgtgtcaaacattgaaagaaatctgcaaaaagaagacggtatcgtttcagtgctagtagcactgatggcaggaaaagcggagataaaatacaagccagagagcattcagcctcttgaaatagtacagctgatccaaaacttgggcttcaatgctgcagtcatagaagatcatactgctacagatggcaatgcagagctcattattacagggatgacttgtgcttcctgtgttcacaatattgaatccaaactaaccagaactaatggcatcttctatgcctcagtagcgcttgctaccagcaaagctcacatccagtttgatcctgaaatcattggacctcgagatattatacaaattattgagggaattggttttcatgcttccgtggccaagagagaccctaatgctcataacttggatcacaaaaaggaaataaaacaatggagaaaatctttcttgtgcagcctagtgtttggaatccctgtcttaatcttaatgatttatatgctaatacctgatggcctacagcacgacactgtggtgctggaacaaaatctaattcctggattatctattttaaatcttctcttctttgtcttgtgcactttggttcagttcctcggtggatggtacttttatgtccaagcctacaaatcactgaagcacaaaacagccaatatggatgtacttattgtactggccacaactattgcttatatatactcttgtgtgatcttgatggtggctatagctgaaaaggcagagaaaagccccatcacattctttgacacaccacctatgttattcgtattcatttcccttgggagatggttggaacacatagcaaagagtaaaacatcagaagcacttgctaaactaatgtctctccaagctactgaagctatcatagtgactcttggacctgaccactccatcatcagggaggagcaggtggctgttgaattggttcagcggggtgacattataaaagttgtccctggtgggaagttcccagttgatggaaaagtcattgaaggcagctctatggcagatgaatcgctcattactggggaagccatgccagttactaaaaaacctgggagcacagtgattgcaggttctataaatgcacatggctcagttcttgttaatgcaactcatgttgggtctgacaccaccctggcacaaattgtgaaattggtagaagaagctcagatgtcaaaggcacccatccagcaattggctgataagtttagtggatattttgttccatttatcatcatcatttcagcagtgacattgttagtgtggatcacaattggttttataaactttgatgttgttcagaaatactttcctcatcagaacaaacacctctcaaaagctgaagtaatactgaggtttgcatttcaaacttcaatcactgtgctgtgcattgcatgcccctgttccttgggcttggctactccaacagctgtgatggtgggcacaggagttgctgctcagaatggtattctcatcaaaggtggaaaacctctggaaatggcccacaagataaagactgtgatgtttgataaaaccgggaccatcacctgtggcgttcctaaagtcatgaggatgctcttgctaagggacacagctaagctgtctctaaagaaggtacttgcaattgtcggcactgcagaagccagcagtgagcatcccttaggaatggctgtcactaaatactgtaaagaggaacttggcacggagagcctgggatactgcacagattttcaggcagtcccgggctgtggaatcagctgtaaagtccgcagcgtggaagctgtactgggccagagtgagcagagtgtgaatgagcagaatgcttacctaagcagtgtcagcacgatttctctgggacacagttcatcaatcatggtctctgaatctgatggtgcagcagcccctctgacatactcagttctgattggaaatcgtgaatggatgagacgcaacggcttgcttatatccagtgatgttaatgatgcaatgacaggccatgaaatgaaaggacagacagccatattggtggctatagatggtgcgttgtatggaatgatcgtgatagctgataccgtcaaacaggaggcagcgctcgctgtgcacaccctgcaaaatatgggaatagacgtggtgctaataacgggggacaacagaaaaactgcaaaagcaattgccactcaggttggcatcaaaaaggtctttgctgaggttctgccctctcacaaagtcgcgaaggttcaggaactccagaataaagggaagaaggttgccatggttggagatggagtcaacgattccccggcattggctggagcggacattggcattgctattggaacaggcacggatgttgccattgaagctgcagatgtcgttcttattcgaaatgacttattggatgtggtggctagtattcatctatcaaagaggacagtaagaagaatacgaataaatctggtccttgccttaatttataatctgcttgggatacctatagcggcagcttccttgcctcacaaagtccccttaggtctgtccagagtgctgttgctaaggagtgttcatgcctattggaattgtgctgcagccctggatggggtcagcagcaatggcagcttcttcagtatctgtggtgctatcttccctgcaactgaaatgttacaagaagccaggaactgaaaggtatgaagcaaaagctcaaggccacatgaagccactgactccttcccaaatcagtgttcacattgggatggatgacaggagacgggatt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]