LOCUS       XM_030564308            4354 bp    mRNA    linear   VRT 24-AUG-2019
DEFINITION  PREDICTED: Gopherus evgoodei ATPase copper transporting beta
            (ATP7B), transcript variant X3, mRNA.
ACCESSION   XM_030564308
VERSION     XM_030564308.1
DBLINK      BioProject: PRJNA559383
KEYWORDS    RefSeq.
SOURCE      Gopherus evgoodei (Goodes thornscrub tortoise)
  ORGANISM  Gopherus evgoodei
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Testudinata; Testudines; Cryptodira; Durocryptodira;
            Testudinoidea; Testudinidae; Gopherus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_044322.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Gopherus evgoodei Annotation Release
                                           100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4354
                     /organism="Gopherus evgoodei"
                     /mol_type="mRNA"
                     /db_xref="taxon:1825980"
                     /chromosome="1"
                     /sex="male"
                     /tissue_type="whole blood"
                     /ecotype="Sinaloan lineage"
                     /country="Mexico: Sonora"
                     /collection_date="2010-08-10"
                     /collected_by="T. Edwards"
     gene            1..4354
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 18 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 1 sample with support for all annotated introns"
                     /db_xref="GeneID:115652357"
     CDS             63..4262
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X3"
                     /protein_id="XP_030420168.1"
                     /db_xref="GeneID:115652357"
                     /translation="

MNALSKSSSPATCVQEPTMKQNFAFDNIGYERSAENMPSLLPQTSTITVNILGMTCQSCVQSIEGRISKVKGIVSIKVSLEQSNAVIKYIQSEISPQEVCQEIGDMGFDASIAEARTTASSVRSTSLGEALMKLRVEGMTCQSCVNTIEGKIGKLHGVLRIKVSLSNQEAVIAYQPYIIQPEDLKKHIDNMGYESTIKSKQAPLKLGMIDLERLQTTCTKKTLATLNNSSVEPVVGKMNSTTTMKLGVEGMHCKSCVKNIEGNISGLPGVQSISVSLEHKNAVVQFNPNLITPVSLQQAIEALPPGNFKVSLPNGVEANNGELLSKAAFSSPQFHSRSSGDQLTSTSVLHIDGMTCGSCVQSIEGTMSQRKGVQHISVSLAERTGIIHYNSAVTNSEELRGAIEDMGFDASILTDTTTWKYMNQPLFRNAAIQPNAWESAAQRTENVSESSHQGYLSDVQPKNSYLGNPKPPSVATTEKCFMQITGMTCASCVSNIERNLQKEDGIVSVLVALMAGKAEIKYKPESIQPLEIVQLIQNLGFNAAVIEDHTATDGNAELIITGMTCASCVHNIESKLTRTNGIFYASVALATSKAHIQFDPEIIGPRDIIQIIEGIGFHASVAKRDPNAHNLDHKKEIKQWRKSFLCSLVFGIPVLILMIYMLIPDGLQHDTVVLEQNLIPGLSILNLLFFVLCTLVQFLGGWYFYVQAYKSLKHKTANMDVLIVLATTIAYIYSCVILMVAIAEKAEKSPITFFDTPPMLFVFISLGRWLEHIAKSKTSEALAKLMSLQATEAIIVTLGPDHSIIREEQVAVELVQRGDIIKVVPGGKFPVDGKVIEGSSMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVNATHVGSDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISAVTLLVWITIGFINFDVVQKYFPHQNKHLSKAEVILRFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITCGVPKVMRMLLLRDTAKLSLKKVLAIVGTAEASSEHPLGMAVTKYCKEELGTESLGYCTDFQAVPGCGISCKVRSVEAVLGQSEQSVNEQNAYLSSVSTISLGHSSSIMVSESDGAAAPLTYSVLIGNREWMRRNGLLISSDVNDAMTGHEMKGQTAILVAIDGALYGMIVIADTVKQEAALAVHTLQNMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNKGKKVAMVGDGVNDSPALAGADIGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLVLALIYNLLGIPIAAASLPHKVPLGLSRVLLLRSVHAYWNCAAALDGVSSNGSFFSICGAIFPATEMLQEARN"

     misc_feature    204..395
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(222..230,237..239)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    459..650
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(477..485,492..494)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    804..971
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(813..821,828..830)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1104..1295
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1122..1130,1137..1139)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1506..1694
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1521..1529,1536..1538)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1731..1922
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1749..1757,1764..1766)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1986..4085
                     /gene="ATP7B"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(2979..2981,2985..2987,4056..4058)
                     /gene="ATP7B"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(3111..3119,3321..3323,3507..3515,3603..3605,
                     3723..3731,3789..3791,3798..3800,3807..3809,3864..3866,
                     3873..3875)
                     /gene="ATP7B"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      

gctctcagaaagaagagaaagtttcacagagttactcggtgggagcatcagaagtcaacagcatgaatgctttgtctaagtctagctcccctgctacttgtgtacaggaaccaaccatgaagcagaattttgcttttgacaacatcggctacgagaggagcgctgaaaatatgccctctctgcttcctcaaacgagcaccatcacagtcaatattttgggtatgacctgccagtcttgtgtgcagtcgatagagggcagaatttccaaggttaagggcattgtgagcatcaaggtctcccttgagcagagcaatgctgtaataaaatatatacagtcagaaataagcccccaagaggtttgccaggaaattggagacatgggctttgatgccagcattgcagaagcaagaactacagcatcatctgtaagatcgacgtccttgggcgaagcactaatgaagctgcgagtagaaggtatgacatgccaatcttgtgtcaacaccattgaaggaaagattggaaaactacatggcgtgctgagaatcaaagtctccctcagtaaccaagaagcagtcattgcttaccagccttacatcattcaacctgaagacctcaaaaaacacattgataacatggggtatgaaagcacaattaagagcaagcaagccccattaaagcttggtatgattgatctagaacgcttgcagactacatgcacaaagaaaactctagccaccttgaacaatagcagtgtggagccagtggtgggcaaaatgaatagtacaactactatgaaactgggagtagaagggatgcactgcaagtcttgcgtcaaaaacatcgaaggaaatatatcaggtcttccaggcgtacaaagtattagtgtgtcattggaacataaaaatgctgttgtgcaatttaacccaaacctaattaccccagtatctttgcaacaagccattgaggcccttccacctggtaactttaaagtctccctccctaatggagtggaagcaaataacggagagcttttatcaaaggcagcattttcatcacctcagtttcatagcagatcctctggggatcagctgacaagcacatctgtacttcatattgatggaatgacctgtgggtcctgtgtacagtccatagaaggcacaatgtcccaaaggaaaggggtacaacatatatcagtttcattagctgaaaggactggaatcatacactacaattcagctgtaactaattcagaagagctaagaggtgctatagaagacatgggatttgatgcttccattctcacagataccaccacttggaaatatatgaatcaacctcttttcaggaacgctgcaattcagcctaatgcttgggagtcagctgcccagagaacagaaaatgtttctgagtcttctcatcaaggctacttgtccgatgtccagccaaagaattcttacctcggtaatccaaagccacccagtgtagcgacaacagaaaagtgctttatgcagatcacaggcatgacctgcgcatcatgtgtgtcaaacattgaaagaaatctgcaaaaagaagacggtatcgtttcagtgctagtagcactgatggcaggaaaagcggagataaaatacaagccagagagcattcagcctcttgaaatagtacagctgatccaaaacttgggcttcaatgctgcagtcatagaagatcatactgctacagatggcaatgcagagctcattattacagggatgacttgtgcttcctgtgttcacaatattgaatccaaactaaccagaactaatggcatcttctatgcctcagtagcgcttgctaccagcaaagctcacatccagtttgatcctgaaatcattggacctcgagatattatacaaattattgagggaattggttttcatgcttccgtggccaagagagaccctaatgctcataacttggatcacaaaaaggaaataaaacaatggagaaaatctttcttgtgcagcctagtgtttggaatccctgtcttaatcttaatgatttatatgctaatacctgatggcctacagcacgacactgtggtgctggaacaaaatctaattcctggattatctattttaaatcttctcttctttgtcttgtgcactttggttcagttcctcggtggatggtacttttatgtccaagcctacaaatcactgaagcacaaaacagccaatatggatgtacttattgtactggccacaactattgcttatatatactcttgtgtgatcttgatggtggctatagctgaaaaggcagagaaaagccccatcacattctttgacacaccacctatgttattcgtattcatttcccttgggagatggttggaacacatagcaaagagtaaaacatcagaagcacttgctaaactaatgtctctccaagctactgaagctatcatagtgactcttggacctgaccactccatcatcagggaggagcaggtggctgttgaattggttcagcggggtgacattataaaagttgtccctggtgggaagttcccagttgatggaaaagtcattgaaggcagctctatggcagatgaatcgctcattactggggaagccatgccagttactaaaaaacctgggagcacagtgattgcaggttctataaatgcacatggctcagttcttgttaatgcaactcatgttgggtctgacaccaccctggcacaaattgtgaaattggtagaagaagctcagatgtcaaaggcacccatccagcaattggctgataagtttagtggatattttgttccatttatcatcatcatttcagcagtgacattgttagtgtggatcacaattggttttataaactttgatgttgttcagaaatactttcctcatcagaacaaacacctctcaaaagctgaagtaatactgaggtttgcatttcaaacttcaatcactgtgctgtgcattgcatgcccctgttccttgggcttggctactccaacagctgtgatggtgggcacaggagttgctgctcagaatggtattctcatcaaaggtggaaaacctctggaaatggcccacaagataaagactgtgatgtttgataaaaccgggaccatcacctgtggcgttcctaaagtcatgaggatgctcttgctaagggacacagctaagctgtctctaaagaaggtacttgcaattgtcggcactgcagaagccagcagtgagcatcccttaggaatggctgtcactaaatactgtaaagaggaacttggcacggagagcctgggatactgcacagattttcaggcagtcccgggctgtggaatcagctgtaaagtccgcagcgtggaagctgtactgggccagagtgagcagagtgtgaatgagcagaatgcttacctaagcagtgtcagcacgatttctctgggacacagttcatcaatcatggtctctgaatctgatggtgcagcagcccctctgacatactcagttctgattggaaatcgtgaatggatgagacgcaacggcttgcttatatccagtgatgttaatgatgcaatgacaggccatgaaatgaaaggacagacagccatattggtggctatagatggtgcgttgtatggaatgatcgtgatagctgataccgtcaaacaggaggcagcgctcgctgtgcacaccctgcaaaatatgggaatagacgtggtgctaataacgggggacaacagaaaaactgcaaaagcaattgccactcaggttggcatcaaaaaggtctttgctgaggttctgccctctcacaaagtcgcgaaggttcaggaactccagaataaagggaagaaggttgccatggttggagatggagtcaacgattccccggcattggctggagcggacattggcattgctattggaacaggcacggatgttgccattgaagctgcagatgtcgttcttattcgaaatgacttattggatgtggtggctagtattcatctatcaaagaggacagtaagaagaatacgaataaatctggtccttgccttaatttataatctgcttgggatacctatagcggcagcttccttgcctcacaaagtccccttaggtctgtccagagtgctgttgctaaggagtgttcatgcctattggaattgtgctgcagccctggatggggtcagcagcaatggcagcttcttcagtatctgtggtgctatcttccctgcaactgaaatgttacaagaagccaggaactgaaaggtatgaagcaaaagctcaaggccacatgaagccactgactccttcccaaatcagtgttcacattgggatggatgacaggagacgggatt

//