ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-12 16:09:05, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XM_030477253 4550 bp mRNA linear VRT 26-MAR-2020
DEFINITION PREDICTED: Strigops habroptila ATPase copper transporting beta
(ATP7B), transcript variant X2, mRNA.
ACCESSION XM_030477253
VERSION XM_030477253.1
DBLINK BioProject: PRJNA558775
KEYWORDS RefSeq.
SOURCE Strigops habroptila (Kakapo)
ORGANISM Strigops habroptila
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
Coelurosauria; Aves; Neognathae; Neoaves; Telluraves; Australaves;
Psittaciformes; Psittacidae; Strigops.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NC_044278.2) annotated using gene prediction method: Gnomon,
supported by EST evidence.
Also see:
Documentation of NCBI's Annotation Process
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI
Annotation Status :: Full annotation
Annotation Name :: Strigops habroptila Annotation
Release 101
Annotation Version :: 101
Annotation Pipeline :: NCBI eukaryotic genome annotation
pipeline
Annotation Software Version :: 8.3
Annotation Method :: Best-placed RefSeq; Gnomon
Features Annotated :: Gene; mRNA; CDS; ncRNA
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..4550
/organism="Strigops habroptila"
/mol_type="mRNA"
/isolate="Jane"
/db_xref="taxon:2489341"
/chromosome="2"
/sex="female"
/tissue_type="blood in lysis buffer or EtOH"
/geo_loc_name="New Zealand: Anchor Island"
/lat_lon="45.757406 S 166.504927 E"
/collection_date="2013-04-13"
/collected_by="Tim Raemaekers, Daryl Eason, Andrew Digby
of Department of Conservation, New Zealand"
gene 1..4550
/gene="ATP7B"
/note="Derived by automated computational analysis using
gene prediction method: Gnomon. Supporting evidence
includes similarity to: 2 ESTs, 2 long SRA reads, 10
Proteins, and 100% coverage of the annotated genomic
feature by RNAseq alignments, including 2 samples with
support for all annotated introns"
/db_xref="GeneID:115604292"
CDS 129..4424
/gene="ATP7B"
/codon_start=1
/product="copper-transporting ATPase 2 isoform X2"
/protein_id="XP_030333113.1"
/db_xref="GeneID:115604292"
/translation="
MKHSFAFDNMGYEDSFETGPSSSSQERTVAVNIVGMTCQSCVQSIEGRISKVKGIVSIKVSLEQNNAVIKYLQSDISPEQICQEIQDMGFDANTAEERLTTATVNLSCLKEAVVKLRIEGMTCQSCATNIEGKIRKLHGVAKIKVSLGNQEAIIAYYPYIIQPDDLKSHISNLGYDCTIKSKSAPLKLGVLNLERLQNANPKETPASLGSDGVDLRVTKMSSTATVAVQIEGMHCNSCVRNIEGNISDLPGIQSIEVSLEHKRAVVQYSPNLITLSALQQAIESLPPGNFKVCLLNGSETNKRASPSPASQCDLFREPLQDMRCTAVIRIDGMTCNSCVQSIEGTISQREGVQRIEVSLAGRTGTIHYDPAVTNGEEIRAAIEDMGFDASVLTDTATGEHKHQPDTSKAAVQPQAPEPPRQGCSSDALPDSPHLHGPNQPSGGTAEKCFLQIMGMTCASCVSTIERNLQKQDGIVSVLVALMAGKAEIKYKPELIQPVEIAQLIQNLGFGATVIEDHEETEGNVELLIAGMTCASCVHNIESKLMRTNGILYASVALATCKAHIQFDPEITGPRDIIKIIEEIGFHASVARRVPNAHNLDHKKEIQQWRKSFLCSLLFGIPVLILMIYMLIPDGEHHGSMVLEQNIIPGLSILNLLFFVLCTFVQFLGGWYFYVQAYKSLKHKMANMDVLIVLATTIAYVYSCVILVVAIVEKAEKSPVTFFDTPPMLFVFIALGRWLEHIAKSKTSEALAKLISLQATEATVVTLGPDHSIIREEQVAVELVQRGDIVKVVPGGKFPVDGKVIEGTSMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVNATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLIVWITIGFINFDVIQKYFPKQNKHVSKAELILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITCGVPKVMRVLLLGDTAVLSLKKVLAVVGTAEASSEHPLGVAVTKYCKEELGTQSLGYCTDFQAVPGCGISCKVGGVEAILDMAEEGLDKLDANRSGDSSAPLGDNTLVMLSESHGPPVSHTYSVLIGNREWMRRNGLHIANDINDAMTDHETKGQTAVLVAIDGMLCGMIAIADTVKQEAALAVHTLKNMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNGRMKVAMVGDGVNDSPALARADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLVLALIYNLLGIPIAAGVFMPIGLVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDTESYEAQAQGHMKPLTPSQISVHIGMDDRRRDSSRPAPWDQISQVSLSSLAADKLPRHNGFVEEEGDKWSLLINGRDEEQYI"
misc_feature 219..404
/gene="ATP7B"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(234..242,249..251)
/gene="ATP7B"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 471..662
/gene="ATP7B"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(489..497,504..506)
/gene="ATP7B"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 810..983
/gene="ATP7B"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(825..833,840..842)
/gene="ATP7B"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 1101..1307
/gene="ATP7B"
/note="Copper chaperone CopZ [Inorganic ion transport and
metabolism]; Region: CopZ; COG2608"
/db_xref="CDD:442020"
misc_feature 1476..1664
/gene="ATP7B"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(1491..1499,1506..1508)
/gene="ATP7B"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 1701..1892
/gene="ATP7B"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(1719..1727,1734..1736)
/gene="ATP7B"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 1956..4097
/gene="ATP7B"
/note="P-type heavy metal-transporting ATPase, similar to
human copper-transporting ATPases, ATP7A and ATP7B;
Region: P-type_ATPase_Cu-like; cd02094"
/db_xref="CDD:319783"
misc_feature order(2949..2951,2955..2957,4026..4028)
/gene="ATP7B"
/note="putative Cu binding site [ion binding]; other site"
/db_xref="CDD:319783"
misc_feature order(3081..3089,3291..3293,3477..3485,3573..3575,
3693..3701,3759..3761,3768..3770,3777..3779,3834..3836,
3843..3845)
/gene="ATP7B"
/note="putative ATP binding site [chemical binding]; other
site"
/db_xref="CDD:319783"
ORIGIN
gactagtttgacagcagctcataccaagtattctctggaataacagaagttgcagaaacattaaaaggtcctaactgtaggctttgtccaatactgattctccccctggctgtgagctggagtctacaatgaaacacagttttgcttttgacaacatgggctatgaggacagctttgaaactgggccctcttcatcttcccaagaacgcactgtggcagtcaacattgtgggaatgacttgccaatcatgtgtgcagtcgatagaaggtcgtatttccaaggtgaagggcattgtgagcattaaagtctctcttgaacaaaacaacgcagtaataaagtatctgcagtcagacataagtcctgagcagatttgccaggaaattcaggatatgggctttgatgccaatacagcagaagagagattgacaacagcaactgtaaatttgtcatgcttgaaagaagcagtagttaagcttcggatagaaggcatgacatgccagtcctgtgccaccaacattgaaggaaagattaggaaactgcatggtgtggcaaaaatcaaggtgtcacttggtaaccaggaagcaattattgcgtactatccttacatcattcagcctgacgacctcaagagtcatatcagtaacctggggtatgactgcaccatcaaaagtaaatcagcccctttgaagctgggtgtcctcaatcttgagcgcttgcagaatgcaaaccccaaggagacaccagcaagtcttgggagtgatggagtagatctacgggtcaccaagatgagtagcacagctacggtggctgtacagatagaaggcatgcactgcaactcatgtgtcagaaacattgaaggaaatatatcagatctgcctggcatacaaagtattgaagtgtctttggagcataaacgtgctgtggtacagtatagcccaaatttaattaccctgtcagctctgcagcaagctattgaatcccttccacctggaaactttaaagtatgcctccttaacggttcagaaacaaataaaagagcatctccatcacctgcttcccaatgtgatcttttcagagagccactgcaagacatgagatgcacggctgtcattaggattgatggcatgacctgcaattcttgcgtacagtccatagaagggaccatatcacagagagaaggagtgcagcgtatagaagtttctttagctggcagaactgggaccatacattatgatccagctgtcaccaatggagaagagataagagctgccatagaagacatggggtttgatgcttctgtactgacagatactgccactggagaacataagcaccagcctgacaccagcaaagctgctgtgcagcctcaagctccagagcctcctcgccaaggctgttcctcagacgctcttccagacagtccacatcttcatgggccaaaccagcccagcggaggaacagctgagaagtgttttttacaaatcatgggcatgacctgtgcatcctgtgtgtctaccattgaaaggaatttgcagaaacaagatggaattgtttcagtgttggtagcactgatggcaggtaaagcagagataaaatacaagccagaacttatacagcctgttgaaatagcacagctgatccagaatttgggttttggtgctactgtcatagaagatcatgaagaaacagaagggaatgtggagcttcttattgcagggatgacttgtgcttcttgtgttcacaatattgaatccaaactcatgagaacaaatggcatattatatgcctcagttgctcttgccacttgcaaagctcacatccagtttgatcctgagattactggacctcgagatattataaaaataattgaggaaattggctttcatgcttctgtggctagaagagttccaaatgcacataacctagatcataaaaaggaaatccagcagtggaggaaatctttcttgtgcagcctgctgtttggtatccctgtcttaatcctaatgatttatatgctaatacctgatggtgagcaccatgggtctatggtgctggaacagaacatcattcctggattatctattttaaaccttctcttctttgtcctgtgcacttttgttcagtttcttggtgggtggtatttttatgtacaagcttacaagtcactgaagcacaagatggccaatatggatgtgctcatcgtactagccacgacgattgcctatgtatattcctgtgtgatcctggtggtagcaatagttgaaaaggcagagaaaagccccgtcactttctttgacactcctccgatgctgttcgtgttcattgccctggggagatggctggaacacatagcaaagagtaagacctcagaagctcttgctaaacttatatctcttcaagccacagaagccaccgtggtgactcttggacctgaccactctatcatcagggaggagcaggtagctgttgaactggttcaaaggggtgacatcgtaaaggttgttcctggtggaaagttcccagtggatggaaaggtcattgaaggcacttctatggcagatgagtctctcattactggggaagctatgccagtcactaaaaagcctgggagcacagtgattgctggttctataaatgcacatggctcagttcttgttaatgcaactcatgttggtaacgataccactctggcacagattgtgaaattagtggaagaagctcaaatgtcaaaggcacccatccagcaactggcagataagtttagtggatattttgtaccatttatcatcatcatttcaacagtgacattgatagtatggatcacaattgggtttataaattttgatgttattcaaaaatattttcctaagcagaataaacacgtttcaaaagctgaactaatactgaggtttgcatttcaaacctcaatcactgtgctgagcattgcatgcccatgttctttaggcttggctacccccacagctgtgatggtgggcacaggtgtagctgcgcagaacggcatcctcatcaaaggtggaaaacccctggaaatggcacacaagatcaagactgtgatgtttgataaaactggcaccatcacgtgcggagttcctaaagtcatgagggtgcttttgctgggagacacagctgtgctctctctgaagaaggtactggcggtggttggcactgcagaagccagcagcgagcaccctctaggagtggcagtcactaaatattgcaaagaggagcttggtactcagagcttgggatactgcaccgacttccaggcagtcccaggctgtggcatcagctgcaaagttggaggtgttgaggctatcctggatatggctgaggagggtctcgataagctggacgctaacaggagtggggacagcagtgctcctctgggagataacacactggtcatgctctcagaatcacatggtccaccagtgtctcacacatactcggtgttgattggaaatcgtgagtggatgcgacgcaatggcttgcatattgcaaatgacataaatgatgcaatgacagaccatgaaacaaaaggacagactgctgtactagtggctatcgatggcatgttgtgtggaatgattgcaattgcagacactgttaagcaggaggcagcccttgctgtgcacacgctgaaaaacatgggaatagatgtggtgctgataacgggggacaatagaaaaactgcaaaagccattgctactcaggttgggatcaaaaaagtctttgctgaggttcttccttctcacaaagttgcaaaggtccaggagctccaaaatgggaggatgaaggttgcaatggttggtgatggagtcaatgattctcctgcactagccagggccgacgttggaattgcaattggaacaggcaccgatgttgccattgaagcagccgatgttgttcttatccgaaatgacttgctggatgtagttgccagtattcacttatcaaagagaacagttcgaagaatacgaataaatctggttcttgccttaatttataatctgcttggaatacccatagcagcaggtgtgttcatgcctattggccttgtgcttcagccttggatgggatcagctgcaatggcagcttcttctgtgtctgtcgtgctgtcttccctgcagctgaaatgttataagaagccagacacagaaagttacgaagcacaagctcaaggccacatgaagccacttactccttcccaaatcagtgttcatattggaatggatgataggaggagggattcatccagaccagctccttgggatcagattagccaagtgtctctctcttccttggctgcagacaagctgccgagacataatgggtttgttgaggaggaaggggacaagtggtcattgctcattaatggaagagatgaagaacagtacatctgaagcactgtattcttagtagaggaggaaatattcctccttgctagtgatggcagggaccgacttcatgaagagcttcaaggttgtaaatgaagtcattccttcagctcacaaaacaattgcaagtca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]