GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 12:27:53, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_030477253            4550 bp    mRNA    linear   VRT 24-AUG-2019
DEFINITION  PREDICTED: Strigops habroptila ATPase copper transporting beta
            (ATP7B), transcript variant X2, mRNA.
ACCESSION   XM_030477253
VERSION     XM_030477253.1
DBLINK      BioProject: PRJNA558775
KEYWORDS    RefSeq.
SOURCE      Strigops habroptila (Kakapo)
  ORGANISM  Strigops habroptila
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Psittaciformes; Psittacidae;
            Strigops.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_044278.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Strigops habroptila Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4550
                     /organism="Strigops habroptila"
                     /mol_type="mRNA"
                     /isolate="Jane"
                     /db_xref="taxon:2489341"
                     /chromosome="2"
                     /sex="female"
                     /tissue_type="blood in lysis buffer or EtOH"
                     /country="New Zealand: Anchor Island"
                     /lat_lon="45.757406 S 166.504927 E"
                     /collection_date="2013-04-13"
                     /collected_by="Tim Raemaekers, Daryl Eason, Andrew Digby
                     of Department of Conservation, New Zealand"
     gene            1..4550
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 ESTs, 4 long SRA reads, 9
                     Proteins, and 100% coverage of the annotated genomic
                     feature by RNAseq alignments, including 2 samples with
                     support for all annotated introns"
                     /db_xref="GeneID:115604292"
     CDS             129..4424
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X2"
                     /protein_id="XP_030333113.1"
                     /db_xref="GeneID:115604292"
                     /translation="
MKHSFAFDNMGYEDSFETGPSSSSQERTVAVNIVGMTCQSCVQSIEGRISKVKGIVSIKVSLEQNNAVIKYLQSDISPEQICQEIQDMGFDANTAEERLTTATVNLSCLKEAVVKLRIEGMTCQSCATNIEGKIRKLHGVAKIKVSLGNQEAIIAYYPYIIQPDDLKSHISNLGYDCTIKSKSAPLKLGVLNLERLQNANPKETPASLGSDGVDLRVTKMSSTATVAVQIEGMHCNSCVRNIEGNISDLPGIQSIEVSLEHKRAVVQYSPNLITLSALQQAIESLPPGNFKVCLLNGSETNKRASPSPASQCDLFREPLQDMRCTAVIRIDGMTCNSCVQSIEGTISQREGVQRIEVSLAGRTGTIHYDPAVTNGEEIRAAIEDMGFDASVLTDTATGEHKHQPDTSKAAVQPQAPEPPRQGCSSDALPDSPHLHGPNQPSGGTAEKCFLQIMGMTCASCVSTIERNLQKQDGIVSVLVALMAGKAEIKYKPELIQPVEIAQLIQNLGFGATVIEDHEETEGNVELLIAGMTCASCVHNIESKLMRTNGILYASVALATCKAHIQFDPEITGPRDIIKIIEEIGFHASVARRVPNAHNLDHKKEIQQWRKSFLCSLLFGIPVLILMIYMLIPDGEHHGSMVLEQNIIPGLSILNLLFFVLCTFVQFLGGWYFYVQAYKSLKHKMANMDVLIVLATTIAYVYSCVILVVAIVEKAEKSPVTFFDTPPMLFVFIALGRWLEHIAKSKTSEALAKLISLQATEATVVTLGPDHSIIREEQVAVELVQRGDIVKVVPGGKFPVDGKVIEGTSMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVNATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLIVWITIGFINFDVIQKYFPKQNKHVSKAELILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITCGVPKVMRVLLLGDTAVLSLKKVLAVVGTAEASSEHPLGVAVTKYCKEELGTQSLGYCTDFQAVPGCGISCKVGGVEAILDMAEEGLDKLDANRSGDSSAPLGDNTLVMLSESHGPPVSHTYSVLIGNREWMRRNGLHIANDINDAMTDHETKGQTAVLVAIDGMLCGMIAIADTVKQEAALAVHTLKNMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNGRMKVAMVGDGVNDSPALARADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLVLALIYNLLGIPIAAGVFMPIGLVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDTESYEAQAQGHMKPLTPSQISVHIGMDDRRRDSSRPAPWDQISQVSLSSLAADKLPRHNGFVEEEGDKWSLLINGRDEEQYI"
ORIGIN      
gactagtttgacagcagctcataccaagtattctctggaataacagaagttgcagaaacattaaaaggtcctaactgtaggctttgtccaatactgattctccccctggctgtgagctggagtctacaatgaaacacagttttgcttttgacaacatgggctatgaggacagctttgaaactgggccctcttcatcttcccaagaacgcactgtggcagtcaacattgtgggaatgacttgccaatcatgtgtgcagtcgatagaaggtcgtatttccaaggtgaagggcattgtgagcattaaagtctctcttgaacaaaacaacgcagtaataaagtatctgcagtcagacataagtcctgagcagatttgccaggaaattcaggatatgggctttgatgccaatacagcagaagagagattgacaacagcaactgtaaatttgtcatgcttgaaagaagcagtagttaagcttcggatagaaggcatgacatgccagtcctgtgccaccaacattgaaggaaagattaggaaactgcatggtgtggcaaaaatcaaggtgtcacttggtaaccaggaagcaattattgcgtactatccttacatcattcagcctgacgacctcaagagtcatatcagtaacctggggtatgactgcaccatcaaaagtaaatcagcccctttgaagctgggtgtcctcaatcttgagcgcttgcagaatgcaaaccccaaggagacaccagcaagtcttgggagtgatggagtagatctacgggtcaccaagatgagtagcacagctacggtggctgtacagatagaaggcatgcactgcaactcatgtgtcagaaacattgaaggaaatatatcagatctgcctggcatacaaagtattgaagtgtctttggagcataaacgtgctgtggtacagtatagcccaaatttaattaccctgtcagctctgcagcaagctattgaatcccttccacctggaaactttaaagtatgcctccttaacggttcagaaacaaataaaagagcatctccatcacctgcttcccaatgtgatcttttcagagagccactgcaagacatgagatgcacggctgtcattaggattgatggcatgacctgcaattcttgcgtacagtccatagaagggaccatatcacagagagaaggagtgcagcgtatagaagtttctttagctggcagaactgggaccatacattatgatccagctgtcaccaatggagaagagataagagctgccatagaagacatggggtttgatgcttctgtactgacagatactgccactggagaacataagcaccagcctgacaccagcaaagctgctgtgcagcctcaagctccagagcctcctcgccaaggctgttcctcagacgctcttccagacagtccacatcttcatgggccaaaccagcccagcggaggaacagctgagaagtgttttttacaaatcatgggcatgacctgtgcatcctgtgtgtctaccattgaaaggaatttgcagaaacaagatggaattgtttcagtgttggtagcactgatggcaggtaaagcagagataaaatacaagccagaacttatacagcctgttgaaatagcacagctgatccagaatttgggttttggtgctactgtcatagaagatcatgaagaaacagaagggaatgtggagcttcttattgcagggatgacttgtgcttcttgtgttcacaatattgaatccaaactcatgagaacaaatggcatattatatgcctcagttgctcttgccacttgcaaagctcacatccagtttgatcctgagattactggacctcgagatattataaaaataattgaggaaattggctttcatgcttctgtggctagaagagttccaaatgcacataacctagatcataaaaaggaaatccagcagtggaggaaatctttcttgtgcagcctgctgtttggtatccctgtcttaatcctaatgatttatatgctaatacctgatggtgagcaccatgggtctatggtgctggaacagaacatcattcctggattatctattttaaaccttctcttctttgtcctgtgcacttttgttcagtttcttggtgggtggtatttttatgtacaagcttacaagtcactgaagcacaagatggccaatatggatgtgctcatcgtactagccacgacgattgcctatgtatattcctgtgtgatcctggtggtagcaatagttgaaaaggcagagaaaagccccgtcactttctttgacactcctccgatgctgttcgtgttcattgccctggggagatggctggaacacatagcaaagagtaagacctcagaagctcttgctaaacttatatctcttcaagccacagaagccaccgtggtgactcttggacctgaccactctatcatcagggaggagcaggtagctgttgaactggttcaaaggggtgacatcgtaaaggttgttcctggtggaaagttcccagtggatggaaaggtcattgaaggcacttctatggcagatgagtctctcattactggggaagctatgccagtcactaaaaagcctgggagcacagtgattgctggttctataaatgcacatggctcagttcttgttaatgcaactcatgttggtaacgataccactctggcacagattgtgaaattagtggaagaagctcaaatgtcaaaggcacccatccagcaactggcagataagtttagtggatattttgtaccatttatcatcatcatttcaacagtgacattgatagtatggatcacaattgggtttataaattttgatgttattcaaaaatattttcctaagcagaataaacacgtttcaaaagctgaactaatactgaggtttgcatttcaaacctcaatcactgtgctgagcattgcatgcccatgttctttaggcttggctacccccacagctgtgatggtgggcacaggtgtagctgcgcagaacggcatcctcatcaaaggtggaaaacccctggaaatggcacacaagatcaagactgtgatgtttgataaaactggcaccatcacgtgcggagttcctaaagtcatgagggtgcttttgctgggagacacagctgtgctctctctgaagaaggtactggcggtggttggcactgcagaagccagcagcgagcaccctctaggagtggcagtcactaaatattgcaaagaggagcttggtactcagagcttgggatactgcaccgacttccaggcagtcccaggctgtggcatcagctgcaaagttggaggtgttgaggctatcctggatatggctgaggagggtctcgataagctggacgctaacaggagtggggacagcagtgctcctctgggagataacacactggtcatgctctcagaatcacatggtccaccagtgtctcacacatactcggtgttgattggaaatcgtgagtggatgcgacgcaatggcttgcatattgcaaatgacataaatgatgcaatgacagaccatgaaacaaaaggacagactgctgtactagtggctatcgatggcatgttgtgtggaatgattgcaattgcagacactgttaagcaggaggcagcccttgctgtgcacacgctgaaaaacatgggaatagatgtggtgctgataacgggggacaatagaaaaactgcaaaagccattgctactcaggttgggatcaaaaaagtctttgctgaggttcttccttctcacaaagttgcaaaggtccaggagctccaaaatgggaggatgaaggttgcaatggttggtgatggagtcaatgattctcctgcactagccagggccgacgttggaattgcaattggaacaggcaccgatgttgccattgaagcagccgatgttgttcttatccgaaatgacttgctggatgtagttgccagtattcacttatcaaagagaacagttcgaagaatacgaataaatctggttcttgccttaatttataatctgcttggaatacccatagcagcaggtgtgttcatgcctattggccttgtgcttcagccttggatgggatcagctgcaatggcagcttcttctgtgtctgtcgtgctgtcttccctgcagctgaaatgttataagaagccagacacagaaagttacgaagcacaagctcaaggccacatgaagccacttactccttcccaaatcagtgttcatattggaatggatgataggaggagggattcatccagaccagctccttgggatcagattagccaagtgtctctctcttccttggctgcagacaagctgccgagacataatgggtttgttgaggaggaaggggacaagtggtcattgctcattaatggaagagatgaagaacagtacatctgaagcactgtattcttagtagaggaggaaatattcctccttgctagtgatggcagggaccgacttcatgaagagcttcaaggttgtaaatgaagtcattccttcagctcacaaaacaattgcaagtca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]