2025-10-15 16:12:57, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS XM_030477253 4550 bp mRNA linear VRT 26-MAR-2020 DEFINITION PREDICTED: Strigops habroptila ATPase copper transporting beta (ATP7B), transcript variant X2, mRNA. ACCESSION XM_030477253 VERSION XM_030477253.1 DBLINK BioProject: PRJNA558775 KEYWORDS RefSeq. SOURCE Strigops habroptila (Kakapo) ORGANISM Strigops habroptila Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Neoaves; Telluraves; Australaves; Psittaciformes; Psittacidae; Strigops. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_044278.2) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Strigops habroptila Annotation Release 101 Annotation Version :: 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.3 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..4550 /organism="Strigops habroptila" /mol_type="mRNA" /isolate="Jane" /db_xref="taxon:2489341" /chromosome="2" /sex="female" /tissue_type="blood in lysis buffer or EtOH" /geo_loc_name="New Zealand: Anchor Island" /lat_lon="45.757406 S 166.504927 E" /collection_date="2013-04-13" /collected_by="Tim Raemaekers, Daryl Eason, Andrew Digby of Department of Conservation, New Zealand" gene 1..4550 /gene="ATP7B" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 2 ESTs, 2 long SRA reads, 10 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 2 samples with support for all annotated introns" /db_xref="GeneID:115604292" CDS 129..4424 /gene="ATP7B" /codon_start=1 /product="copper-transporting ATPase 2 isoform X2" /protein_id="XP_030333113.1" /db_xref="GeneID:115604292" /translation="
MKHSFAFDNMGYEDSFETGPSSSSQERTVAVNIVGMTCQSCVQSIEGRISKVKGIVSIKVSLEQNNAVIKYLQSDISPEQICQEIQDMGFDANTAEERLTTATVNLSCLKEAVVKLRIEGMTCQSCATNIEGKIRKLHGVAKIKVSLGNQEAIIAYYPYIIQPDDLKSHISNLGYDCTIKSKSAPLKLGVLNLERLQNANPKETPASLGSDGVDLRVTKMSSTATVAVQIEGMHCNSCVRNIEGNISDLPGIQSIEVSLEHKRAVVQYSPNLITLSALQQAIESLPPGNFKVCLLNGSETNKRASPSPASQCDLFREPLQDMRCTAVIRIDGMTCNSCVQSIEGTISQREGVQRIEVSLAGRTGTIHYDPAVTNGEEIRAAIEDMGFDASVLTDTATGEHKHQPDTSKAAVQPQAPEPPRQGCSSDALPDSPHLHGPNQPSGGTAEKCFLQIMGMTCASCVSTIERNLQKQDGIVSVLVALMAGKAEIKYKPELIQPVEIAQLIQNLGFGATVIEDHEETEGNVELLIAGMTCASCVHNIESKLMRTNGILYASVALATCKAHIQFDPEITGPRDIIKIIEEIGFHASVARRVPNAHNLDHKKEIQQWRKSFLCSLLFGIPVLILMIYMLIPDGEHHGSMVLEQNIIPGLSILNLLFFVLCTFVQFLGGWYFYVQAYKSLKHKMANMDVLIVLATTIAYVYSCVILVVAIVEKAEKSPVTFFDTPPMLFVFIALGRWLEHIAKSKTSEALAKLISLQATEATVVTLGPDHSIIREEQVAVELVQRGDIVKVVPGGKFPVDGKVIEGTSMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVNATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLIVWITIGFINFDVIQKYFPKQNKHVSKAELILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITCGVPKVMRVLLLGDTAVLSLKKVLAVVGTAEASSEHPLGVAVTKYCKEELGTQSLGYCTDFQAVPGCGISCKVGGVEAILDMAEEGLDKLDANRSGDSSAPLGDNTLVMLSESHGPPVSHTYSVLIGNREWMRRNGLHIANDINDAMTDHETKGQTAVLVAIDGMLCGMIAIADTVKQEAALAVHTLKNMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNGRMKVAMVGDGVNDSPALARADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLVLALIYNLLGIPIAAGVFMPIGLVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDTESYEAQAQGHMKPLTPSQISVHIGMDDRRRDSSRPAPWDQISQVSLSSLAADKLPRHNGFVEEEGDKWSLLINGRDEEQYI"
misc_feature 219..404 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(234..242,249..251) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 471..662 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(489..497,504..506) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 810..983 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(825..833,840..842) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1101..1307 /gene="ATP7B" /note="Copper chaperone CopZ [Inorganic ion transport and metabolism]; Region: CopZ; COG2608" /db_xref="CDD:442020" misc_feature 1476..1664 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1491..1499,1506..1508) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1701..1892 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1719..1727,1734..1736) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1956..4097 /gene="ATP7B" /note="P-type heavy metal-transporting ATPase, similar to human copper-transporting ATPases, ATP7A and ATP7B; Region: P-type_ATPase_Cu-like; cd02094" /db_xref="CDD:319783" misc_feature order(2949..2951,2955..2957,4026..4028) /gene="ATP7B" /note="putative Cu binding site [ion binding]; other site" /db_xref="CDD:319783" misc_feature order(3081..3089,3291..3293,3477..3485,3573..3575, 3693..3701,3759..3761,3768..3770,3777..3779,3834..3836, 3843..3845) /gene="ATP7B" /note="putative ATP binding site [chemical binding]; other site" /db_xref="CDD:319783" ORIGIN
gactagtttgacagcagctcataccaagtattctctggaataacagaagttgcagaaacattaaaaggtcctaactgtaggctttgtccaatactgattctccccctggctgtgagctggagtctacaatgaaacacagttttgcttttgacaacatgggctatgaggacagctttgaaactgggccctcttcatcttcccaagaacgcactgtggcagtcaacattgtgggaatgacttgccaatcatgtgtgcagtcgatagaaggtcgtatttccaaggtgaagggcattgtgagcattaaagtctctcttgaacaaaacaacgcagtaataaagtatctgcagtcagacataagtcctgagcagatttgccaggaaattcaggatatgggctttgatgccaatacagcagaagagagattgacaacagcaactgtaaatttgtcatgcttgaaagaagcagtagttaagcttcggatagaaggcatgacatgccagtcctgtgccaccaacattgaaggaaagattaggaaactgcatggtgtggcaaaaatcaaggtgtcacttggtaaccaggaagcaattattgcgtactatccttacatcattcagcctgacgacctcaagagtcatatcagtaacctggggtatgactgcaccatcaaaagtaaatcagcccctttgaagctgggtgtcctcaatcttgagcgcttgcagaatgcaaaccccaaggagacaccagcaagtcttgggagtgatggagtagatctacgggtcaccaagatgagtagcacagctacggtggctgtacagatagaaggcatgcactgcaactcatgtgtcagaaacattgaaggaaatatatcagatctgcctggcatacaaagtattgaagtgtctttggagcataaacgtgctgtggtacagtatagcccaaatttaattaccctgtcagctctgcagcaagctattgaatcccttccacctggaaactttaaagtatgcctccttaacggttcagaaacaaataaaagagcatctccatcacctgcttcccaatgtgatcttttcagagagccactgcaagacatgagatgcacggctgtcattaggattgatggcatgacctgcaattcttgcgtacagtccatagaagggaccatatcacagagagaaggagtgcagcgtatagaagtttctttagctggcagaactgggaccatacattatgatccagctgtcaccaatggagaagagataagagctgccatagaagacatggggtttgatgcttctgtactgacagatactgccactggagaacataagcaccagcctgacaccagcaaagctgctgtgcagcctcaagctccagagcctcctcgccaaggctgttcctcagacgctcttccagacagtccacatcttcatgggccaaaccagcccagcggaggaacagctgagaagtgttttttacaaatcatgggcatgacctgtgcatcctgtgtgtctaccattgaaaggaatttgcagaaacaagatggaattgtttcagtgttggtagcactgatggcaggtaaagcagagataaaatacaagccagaacttatacagcctgttgaaatagcacagctgatccagaatttgggttttggtgctactgtcatagaagatcatgaagaaacagaagggaatgtggagcttcttattgcagggatgacttgtgcttcttgtgttcacaatattgaatccaaactcatgagaacaaatggcatattatatgcctcagttgctcttgccacttgcaaagctcacatccagtttgatcctgagattactggacctcgagatattataaaaataattgaggaaattggctttcatgcttctgtggctagaagagttccaaatgcacataacctagatcataaaaaggaaatccagcagtggaggaaatctttcttgtgcagcctgctgtttggtatccctgtcttaatcctaatgatttatatgctaatacctgatggtgagcaccatgggtctatggtgctggaacagaacatcattcctggattatctattttaaaccttctcttctttgtcctgtgcacttttgttcagtttcttggtgggtggtatttttatgtacaagcttacaagtcactgaagcacaagatggccaatatggatgtgctcatcgtactagccacgacgattgcctatgtatattcctgtgtgatcctggtggtagcaatagttgaaaaggcagagaaaagccccgtcactttctttgacactcctccgatgctgttcgtgttcattgccctggggagatggctggaacacatagcaaagagtaagacctcagaagctcttgctaaacttatatctcttcaagccacagaagccaccgtggtgactcttggacctgaccactctatcatcagggaggagcaggtagctgttgaactggttcaaaggggtgacatcgtaaaggttgttcctggtggaaagttcccagtggatggaaaggtcattgaaggcacttctatggcagatgagtctctcattactggggaagctatgccagtcactaaaaagcctgggagcacagtgattgctggttctataaatgcacatggctcagttcttgttaatgcaactcatgttggtaacgataccactctggcacagattgtgaaattagtggaagaagctcaaatgtcaaaggcacccatccagcaactggcagataagtttagtggatattttgtaccatttatcatcatcatttcaacagtgacattgatagtatggatcacaattgggtttataaattttgatgttattcaaaaatattttcctaagcagaataaacacgtttcaaaagctgaactaatactgaggtttgcatttcaaacctcaatcactgtgctgagcattgcatgcccatgttctttaggcttggctacccccacagctgtgatggtgggcacaggtgtagctgcgcagaacggcatcctcatcaaaggtggaaaacccctggaaatggcacacaagatcaagactgtgatgtttgataaaactggcaccatcacgtgcggagttcctaaagtcatgagggtgcttttgctgggagacacagctgtgctctctctgaagaaggtactggcggtggttggcactgcagaagccagcagcgagcaccctctaggagtggcagtcactaaatattgcaaagaggagcttggtactcagagcttgggatactgcaccgacttccaggcagtcccaggctgtggcatcagctgcaaagttggaggtgttgaggctatcctggatatggctgaggagggtctcgataagctggacgctaacaggagtggggacagcagtgctcctctgggagataacacactggtcatgctctcagaatcacatggtccaccagtgtctcacacatactcggtgttgattggaaatcgtgagtggatgcgacgcaatggcttgcatattgcaaatgacataaatgatgcaatgacagaccatgaaacaaaaggacagactgctgtactagtggctatcgatggcatgttgtgtggaatgattgcaattgcagacactgttaagcaggaggcagcccttgctgtgcacacgctgaaaaacatgggaatagatgtggtgctgataacgggggacaatagaaaaactgcaaaagccattgctactcaggttgggatcaaaaaagtctttgctgaggttcttccttctcacaaagttgcaaaggtccaggagctccaaaatgggaggatgaaggttgcaatggttggtgatggagtcaatgattctcctgcactagccagggccgacgttggaattgcaattggaacaggcaccgatgttgccattgaagcagccgatgttgttcttatccgaaatgacttgctggatgtagttgccagtattcacttatcaaagagaacagttcgaagaatacgaataaatctggttcttgccttaatttataatctgcttggaatacccatagcagcaggtgtgttcatgcctattggccttgtgcttcagccttggatgggatcagctgcaatggcagcttcttctgtgtctgtcgtgctgtcttccctgcagctgaaatgttataagaagccagacacagaaagttacgaagcacaagctcaaggccacatgaagccacttactccttcccaaatcagtgttcatattggaatggatgataggaggagggattcatccagaccagctccttgggatcagattagccaagtgtctctctcttccttggctgcagacaagctgccgagacataatgggtttgttgaggaggaaggggacaagtggtcattgctcattaatggaagagatgaagaacagtacatctgaagcactgtattcttagtagaggaggaaatattcctccttgctagtgatggcagggaccgacttcatgaagagcttcaaggttgtaaatgaagtcattccttcagctcacaaaacaattgcaagtca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]