LOCUS       XM_030477253            4550 bp    mRNA    linear   VRT 26-MAR-2020
DEFINITION  PREDICTED: Strigops habroptila ATPase copper transporting beta
            (ATP7B), transcript variant X2, mRNA.
ACCESSION   XM_030477253
VERSION     XM_030477253.1
DBLINK      BioProject: PRJNA558775
KEYWORDS    RefSeq.
SOURCE      Strigops habroptila (Kakapo)
  ORGANISM  Strigops habroptila
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Psittaciformes; Psittacidae;
            Strigops.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_044278.2) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Strigops habroptila Annotation
                                           Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4550
                     /organism="Strigops habroptila"
                     /mol_type="mRNA"
                     /isolate="Jane"
                     /db_xref="taxon:2489341"
                     /chromosome="2"
                     /sex="female"
                     /tissue_type="blood in lysis buffer or EtOH"
                     /country="New Zealand: Anchor Island"
                     /lat_lon="45.757406 S 166.504927 E"
                     /collection_date="2013-04-13"
                     /collected_by="Tim Raemaekers, Daryl Eason, Andrew Digby
                     of Department of Conservation, New Zealand"
     gene            1..4550
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 ESTs, 2 long SRA reads, 10
                     Proteins, and 100% coverage of the annotated genomic
                     feature by RNAseq alignments, including 2 samples with
                     support for all annotated introns"
                     /db_xref="GeneID:115604292"
     CDS             129..4424
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X2"
                     /protein_id="XP_030333113.1"
                     /db_xref="GeneID:115604292"
                     /translation="

MKHSFAFDNMGYEDSFETGPSSSSQERTVAVNIVGMTCQSCVQSIEGRISKVKGIVSIKVSLEQNNAVIKYLQSDISPEQICQEIQDMGFDANTAEERLTTATVNLSCLKEAVVKLRIEGMTCQSCATNIEGKIRKLHGVAKIKVSLGNQEAIIAYYPYIIQPDDLKSHISNLGYDCTIKSKSAPLKLGVLNLERLQNANPKETPASLGSDGVDLRVTKMSSTATVAVQIEGMHCNSCVRNIEGNISDLPGIQSIEVSLEHKRAVVQYSPNLITLSALQQAIESLPPGNFKVCLLNGSETNKRASPSPASQCDLFREPLQDMRCTAVIRIDGMTCNSCVQSIEGTISQREGVQRIEVSLAGRTGTIHYDPAVTNGEEIRAAIEDMGFDASVLTDTATGEHKHQPDTSKAAVQPQAPEPPRQGCSSDALPDSPHLHGPNQPSGGTAEKCFLQIMGMTCASCVSTIERNLQKQDGIVSVLVALMAGKAEIKYKPELIQPVEIAQLIQNLGFGATVIEDHEETEGNVELLIAGMTCASCVHNIESKLMRTNGILYASVALATCKAHIQFDPEITGPRDIIKIIEEIGFHASVARRVPNAHNLDHKKEIQQWRKSFLCSLLFGIPVLILMIYMLIPDGEHHGSMVLEQNIIPGLSILNLLFFVLCTFVQFLGGWYFYVQAYKSLKHKMANMDVLIVLATTIAYVYSCVILVVAIVEKAEKSPVTFFDTPPMLFVFIALGRWLEHIAKSKTSEALAKLISLQATEATVVTLGPDHSIIREEQVAVELVQRGDIVKVVPGGKFPVDGKVIEGTSMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVNATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLIVWITIGFINFDVIQKYFPKQNKHVSKAELILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITCGVPKVMRVLLLGDTAVLSLKKVLAVVGTAEASSEHPLGVAVTKYCKEELGTQSLGYCTDFQAVPGCGISCKVGGVEAILDMAEEGLDKLDANRSGDSSAPLGDNTLVMLSESHGPPVSHTYSVLIGNREWMRRNGLHIANDINDAMTDHETKGQTAVLVAIDGMLCGMIAIADTVKQEAALAVHTLKNMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNGRMKVAMVGDGVNDSPALARADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLVLALIYNLLGIPIAAGVFMPIGLVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDTESYEAQAQGHMKPLTPSQISVHIGMDDRRRDSSRPAPWDQISQVSLSSLAADKLPRHNGFVEEEGDKWSLLINGRDEEQYI"

     misc_feature    219..404
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(234..242,249..251)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    471..662
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(489..497,504..506)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    810..983
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(825..833,840..842)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1107..1298
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1125..1133,1140..1142)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1476..1664
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1491..1499,1506..1508)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1701..1892
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1719..1727,1734..1736)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1956..4097
                     /gene="ATP7B"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(2949..2951,2955..2957,4026..4028)
                     /gene="ATP7B"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(3081..3089,3291..3293,3477..3485,3573..3575,
                     3693..3701,3759..3761,3768..3770,3777..3779,3834..3836,
                     3843..3845)
                     /gene="ATP7B"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      

gactagtttgacagcagctcataccaagtattctctggaataacagaagttgcagaaacattaaaaggtcctaactgtaggctttgtccaatactgattctccccctggctgtgagctggagtctacaatgaaacacagttttgcttttgacaacatgggctatgaggacagctttgaaactgggccctcttcatcttcccaagaacgcactgtggcagtcaacattgtgggaatgacttgccaatcatgtgtgcagtcgatagaaggtcgtatttccaaggtgaagggcattgtgagcattaaagtctctcttgaacaaaacaacgcagtaataaagtatctgcagtcagacataagtcctgagcagatttgccaggaaattcaggatatgggctttgatgccaatacagcagaagagagattgacaacagcaactgtaaatttgtcatgcttgaaagaagcagtagttaagcttcggatagaaggcatgacatgccagtcctgtgccaccaacattgaaggaaagattaggaaactgcatggtgtggcaaaaatcaaggtgtcacttggtaaccaggaagcaattattgcgtactatccttacatcattcagcctgacgacctcaagagtcatatcagtaacctggggtatgactgcaccatcaaaagtaaatcagcccctttgaagctgggtgtcctcaatcttgagcgcttgcagaatgcaaaccccaaggagacaccagcaagtcttgggagtgatggagtagatctacgggtcaccaagatgagtagcacagctacggtggctgtacagatagaaggcatgcactgcaactcatgtgtcagaaacattgaaggaaatatatcagatctgcctggcatacaaagtattgaagtgtctttggagcataaacgtgctgtggtacagtatagcccaaatttaattaccctgtcagctctgcagcaagctattgaatcccttccacctggaaactttaaagtatgcctccttaacggttcagaaacaaataaaagagcatctccatcacctgcttcccaatgtgatcttttcagagagccactgcaagacatgagatgcacggctgtcattaggattgatggcatgacctgcaattcttgcgtacagtccatagaagggaccatatcacagagagaaggagtgcagcgtatagaagtttctttagctggcagaactgggaccatacattatgatccagctgtcaccaatggagaagagataagagctgccatagaagacatggggtttgatgcttctgtactgacagatactgccactggagaacataagcaccagcctgacaccagcaaagctgctgtgcagcctcaagctccagagcctcctcgccaaggctgttcctcagacgctcttccagacagtccacatcttcatgggccaaaccagcccagcggaggaacagctgagaagtgttttttacaaatcatgggcatgacctgtgcatcctgtgtgtctaccattgaaaggaatttgcagaaacaagatggaattgtttcagtgttggtagcactgatggcaggtaaagcagagataaaatacaagccagaacttatacagcctgttgaaatagcacagctgatccagaatttgggttttggtgctactgtcatagaagatcatgaagaaacagaagggaatgtggagcttcttattgcagggatgacttgtgcttcttgtgttcacaatattgaatccaaactcatgagaacaaatggcatattatatgcctcagttgctcttgccacttgcaaagctcacatccagtttgatcctgagattactggacctcgagatattataaaaataattgaggaaattggctttcatgcttctgtggctagaagagttccaaatgcacataacctagatcataaaaaggaaatccagcagtggaggaaatctttcttgtgcagcctgctgtttggtatccctgtcttaatcctaatgatttatatgctaatacctgatggtgagcaccatgggtctatggtgctggaacagaacatcattcctggattatctattttaaaccttctcttctttgtcctgtgcacttttgttcagtttcttggtgggtggtatttttatgtacaagcttacaagtcactgaagcacaagatggccaatatggatgtgctcatcgtactagccacgacgattgcctatgtatattcctgtgtgatcctggtggtagcaatagttgaaaaggcagagaaaagccccgtcactttctttgacactcctccgatgctgttcgtgttcattgccctggggagatggctggaacacatagcaaagagtaagacctcagaagctcttgctaaacttatatctcttcaagccacagaagccaccgtggtgactcttggacctgaccactctatcatcagggaggagcaggtagctgttgaactggttcaaaggggtgacatcgtaaaggttgttcctggtggaaagttcccagtggatggaaaggtcattgaaggcacttctatggcagatgagtctctcattactggggaagctatgccagtcactaaaaagcctgggagcacagtgattgctggttctataaatgcacatggctcagttcttgttaatgcaactcatgttggtaacgataccactctggcacagattgtgaaattagtggaagaagctcaaatgtcaaaggcacccatccagcaactggcagataagtttagtggatattttgtaccatttatcatcatcatttcaacagtgacattgatagtatggatcacaattgggtttataaattttgatgttattcaaaaatattttcctaagcagaataaacacgtttcaaaagctgaactaatactgaggtttgcatttcaaacctcaatcactgtgctgagcattgcatgcccatgttctttaggcttggctacccccacagctgtgatggtgggcacaggtgtagctgcgcagaacggcatcctcatcaaaggtggaaaacccctggaaatggcacacaagatcaagactgtgatgtttgataaaactggcaccatcacgtgcggagttcctaaagtcatgagggtgcttttgctgggagacacagctgtgctctctctgaagaaggtactggcggtggttggcactgcagaagccagcagcgagcaccctctaggagtggcagtcactaaatattgcaaagaggagcttggtactcagagcttgggatactgcaccgacttccaggcagtcccaggctgtggcatcagctgcaaagttggaggtgttgaggctatcctggatatggctgaggagggtctcgataagctggacgctaacaggagtggggacagcagtgctcctctgggagataacacactggtcatgctctcagaatcacatggtccaccagtgtctcacacatactcggtgttgattggaaatcgtgagtggatgcgacgcaatggcttgcatattgcaaatgacataaatgatgcaatgacagaccatgaaacaaaaggacagactgctgtactagtggctatcgatggcatgttgtgtggaatgattgcaattgcagacactgttaagcaggaggcagcccttgctgtgcacacgctgaaaaacatgggaatagatgtggtgctgataacgggggacaatagaaaaactgcaaaagccattgctactcaggttgggatcaaaaaagtctttgctgaggttcttccttctcacaaagttgcaaaggtccaggagctccaaaatgggaggatgaaggttgcaatggttggtgatggagtcaatgattctcctgcactagccagggccgacgttggaattgcaattggaacaggcaccgatgttgccattgaagcagccgatgttgttcttatccgaaatgacttgctggatgtagttgccagtattcacttatcaaagagaacagttcgaagaatacgaataaatctggttcttgccttaatttataatctgcttggaatacccatagcagcaggtgtgttcatgcctattggccttgtgcttcagccttggatgggatcagctgcaatggcagcttcttctgtgtctgtcgtgctgtcttccctgcagctgaaatgttataagaagccagacacagaaagttacgaagcacaagctcaaggccacatgaagccacttactccttcccaaatcagtgttcatattggaatggatgataggaggagggattcatccagaccagctccttgggatcagattagccaagtgtctctctcttccttggctgcagacaagctgccgagacataatgggtttgttgaggaggaaggggacaagtggtcattgctcattaatggaagagatgaagaacagtacatctgaagcactgtattcttagtagaggaggaaatattcctccttgctagtgatggcagggaccgacttcatgaagagcttcaaggttgtaaatgaagtcattccttcagctcacaaaacaattgcaagtca

//