LOCUS       XM_030477252            4885 bp    mRNA    linear   VRT 26-MAR-2020
DEFINITION  PREDICTED: Strigops habroptila ATPase copper transporting beta
            (ATP7B), transcript variant X1, mRNA.
ACCESSION   XM_030477252
VERSION     XM_030477252.1
DBLINK      BioProject: PRJNA558775
KEYWORDS    RefSeq.
SOURCE      Strigops habroptila (Kakapo)
  ORGANISM  Strigops habroptila
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Psittaciformes; Psittacidae;
            Strigops.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_044278.2) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Strigops habroptila Annotation
                                           Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4885
                     /organism="Strigops habroptila"
                     /mol_type="mRNA"
                     /isolate="Jane"
                     /db_xref="taxon:2489341"
                     /chromosome="2"
                     /sex="female"
                     /tissue_type="blood in lysis buffer or EtOH"
                     /country="New Zealand: Anchor Island"
                     /lat_lon="45.757406 S 166.504927 E"
                     /collection_date="2013-04-13"
                     /collected_by="Tim Raemaekers, Daryl Eason, Andrew Digby
                     of Department of Conservation, New Zealand"
     gene            1..4885
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 ESTs, 3 long SRA reads, 11
                     Proteins, and 100% coverage of the annotated genomic
                     feature by RNAseq alignments, including 2 samples with
                     support for all annotated introns"
                     /db_xref="GeneID:115604292"
     CDS             167..4759
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X1"
                     /protein_id="XP_030333112.1"
                     /db_xref="GeneID:115604292"
                     /translation="

MERKLDNKMKRELSCLATLNNKNITLVSIRKRQAAHDVPELLIIGEKSKTGSPVKASSNSQKEEKLLQSYSMGMPEVNAVERQALSNTDSPPGCELESTMKHSFAFDNMGYEDSFETGPSSSSQERTVAVNIVGMTCQSCVQSIEGRISKVKGIVSIKVSLEQNNAVIKYLQSDISPEQICQEIQDMGFDANTAEERLTTATVNLSCLKEAVVKLRIEGMTCQSCATNIEGKIRKLHGVAKIKVSLGNQEAIIAYYPYIIQPDDLKSHISNLGYDCTIKSKSAPLKLGVLNLERLQNANPKETPASLGSDGVDLRVTKMSSTATVAVQIEGMHCNSCVRNIEGNISDLPGIQSIEVSLEHKRAVVQYSPNLITLSALQQAIESLPPGNFKVCLLNGSETNKRASPSPASQCDLFREPLQDMRCTAVIRIDGMTCNSCVQSIEGTISQREGVQRIEVSLAGRTGTIHYDPAVTNGEEIRAAIEDMGFDASVLTDTATGEHKHQPDTSKAAVQPQAPEPPRQGCSSDALPDSPHLHGPNQPSGGTAEKCFLQIMGMTCASCVSTIERNLQKQDGIVSVLVALMAGKAEIKYKPELIQPVEIAQLIQNLGFGATVIEDHEETEGNVELLIAGMTCASCVHNIESKLMRTNGILYASVALATCKAHIQFDPEITGPRDIIKIIEEIGFHASVARRVPNAHNLDHKKEIQQWRKSFLCSLLFGIPVLILMIYMLIPDGEHHGSMVLEQNIIPGLSILNLLFFVLCTFVQFLGGWYFYVQAYKSLKHKMANMDVLIVLATTIAYVYSCVILVVAIVEKAEKSPVTFFDTPPMLFVFIALGRWLEHIAKSKTSEALAKLISLQATEATVVTLGPDHSIIREEQVAVELVQRGDIVKVVPGGKFPVDGKVIEGTSMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVNATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLIVWITIGFINFDVIQKYFPKQNKHVSKAELILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITCGVPKVMRVLLLGDTAVLSLKKVLAVVGTAEASSEHPLGVAVTKYCKEELGTQSLGYCTDFQAVPGCGISCKVGGVEAILDMAEEGLDKLDANRSGDSSAPLGDNTLVMLSESHGPPVSHTYSVLIGNREWMRRNGLHIANDINDAMTDHETKGQTAVLVAIDGMLCGMIAIADTVKQEAALAVHTLKNMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNGRMKVAMVGDGVNDSPALARADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLVLALIYNLLGIPIAAGVFMPIGLVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDTESYEAQAQGHMKPLTPSQISVHIGMDDRRRDSSRPAPWDQISQVSLSSLAADKLPRHNGFVEEEGDKWSLLINGRDEEQYI"

     misc_feature    554..739
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(569..577,584..586)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    806..997
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(824..832,839..841)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1145..1318
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1160..1168,1175..1177)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1442..1633
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1460..1468,1475..1477)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1811..1999
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1826..1834,1841..1843)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2036..2227
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(2054..2062,2069..2071)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2291..4432
                     /gene="ATP7B"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(3284..3286,3290..3292,4361..4363)
                     /gene="ATP7B"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(3416..3424,3626..3628,3812..3820,3908..3910,
                     4028..4036,4094..4096,4103..4105,4112..4114,4169..4171,
                     4178..4180)
                     /gene="ATP7B"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      

catctgggattttgtgatgaatgcctaatgagcacgttgattagacgggcagaagtcttcaagccattgtaaatgtagctgaaagaagtgtggctgataagacactgaataaccactcttgtaaagctttcctttggagttgcaatatttaaagtccagaaagataatggagagaaagctggacaataaaatgaaaagggaactgtcctgcttagctactttgaacaacaaaaacataaccctggtgtctattcgtaagcggcaggcagctcatgatgtgcctgaactactgattattggtgaaaagtccaagacaggatctccggtaaaagcaagcagtaactcgcagaaagaagagaaacttttgcagagttactccatgggaatgccagaagtcaatgcagttgaaagacaggctttgtccaatactgattctccccctggctgtgagctggagtctacaatgaaacacagttttgcttttgacaacatgggctatgaggacagctttgaaactgggccctcttcatcttcccaagaacgcactgtggcagtcaacattgtgggaatgacttgccaatcatgtgtgcagtcgatagaaggtcgtatttccaaggtgaagggcattgtgagcattaaagtctctcttgaacaaaacaacgcagtaataaagtatctgcagtcagacataagtcctgagcagatttgccaggaaattcaggatatgggctttgatgccaatacagcagaagagagattgacaacagcaactgtaaatttgtcatgcttgaaagaagcagtagttaagcttcggatagaaggcatgacatgccagtcctgtgccaccaacattgaaggaaagattaggaaactgcatggtgtggcaaaaatcaaggtgtcacttggtaaccaggaagcaattattgcgtactatccttacatcattcagcctgacgacctcaagagtcatatcagtaacctggggtatgactgcaccatcaaaagtaaatcagcccctttgaagctgggtgtcctcaatcttgagcgcttgcagaatgcaaaccccaaggagacaccagcaagtcttgggagtgatggagtagatctacgggtcaccaagatgagtagcacagctacggtggctgtacagatagaaggcatgcactgcaactcatgtgtcagaaacattgaaggaaatatatcagatctgcctggcatacaaagtattgaagtgtctttggagcataaacgtgctgtggtacagtatagcccaaatttaattaccctgtcagctctgcagcaagctattgaatcccttccacctggaaactttaaagtatgcctccttaacggttcagaaacaaataaaagagcatctccatcacctgcttcccaatgtgatcttttcagagagccactgcaagacatgagatgcacggctgtcattaggattgatggcatgacctgcaattcttgcgtacagtccatagaagggaccatatcacagagagaaggagtgcagcgtatagaagtttctttagctggcagaactgggaccatacattatgatccagctgtcaccaatggagaagagataagagctgccatagaagacatggggtttgatgcttctgtactgacagatactgccactggagaacataagcaccagcctgacaccagcaaagctgctgtgcagcctcaagctccagagcctcctcgccaaggctgttcctcagacgctcttccagacagtccacatcttcatgggccaaaccagcccagcggaggaacagctgagaagtgttttttacaaatcatgggcatgacctgtgcatcctgtgtgtctaccattgaaaggaatttgcagaaacaagatggaattgtttcagtgttggtagcactgatggcaggtaaagcagagataaaatacaagccagaacttatacagcctgttgaaatagcacagctgatccagaatttgggttttggtgctactgtcatagaagatcatgaagaaacagaagggaatgtggagcttcttattgcagggatgacttgtgcttcttgtgttcacaatattgaatccaaactcatgagaacaaatggcatattatatgcctcagttgctcttgccacttgcaaagctcacatccagtttgatcctgagattactggacctcgagatattataaaaataattgaggaaattggctttcatgcttctgtggctagaagagttccaaatgcacataacctagatcataaaaaggaaatccagcagtggaggaaatctttcttgtgcagcctgctgtttggtatccctgtcttaatcctaatgatttatatgctaatacctgatggtgagcaccatgggtctatggtgctggaacagaacatcattcctggattatctattttaaaccttctcttctttgtcctgtgcacttttgttcagtttcttggtgggtggtatttttatgtacaagcttacaagtcactgaagcacaagatggccaatatggatgtgctcatcgtactagccacgacgattgcctatgtatattcctgtgtgatcctggtggtagcaatagttgaaaaggcagagaaaagccccgtcactttctttgacactcctccgatgctgttcgtgttcattgccctggggagatggctggaacacatagcaaagagtaagacctcagaagctcttgctaaacttatatctcttcaagccacagaagccaccgtggtgactcttggacctgaccactctatcatcagggaggagcaggtagctgttgaactggttcaaaggggtgacatcgtaaaggttgttcctggtggaaagttcccagtggatggaaaggtcattgaaggcacttctatggcagatgagtctctcattactggggaagctatgccagtcactaaaaagcctgggagcacagtgattgctggttctataaatgcacatggctcagttcttgttaatgcaactcatgttggtaacgataccactctggcacagattgtgaaattagtggaagaagctcaaatgtcaaaggcacccatccagcaactggcagataagtttagtggatattttgtaccatttatcatcatcatttcaacagtgacattgatagtatggatcacaattgggtttataaattttgatgttattcaaaaatattttcctaagcagaataaacacgtttcaaaagctgaactaatactgaggtttgcatttcaaacctcaatcactgtgctgagcattgcatgcccatgttctttaggcttggctacccccacagctgtgatggtgggcacaggtgtagctgcgcagaacggcatcctcatcaaaggtggaaaacccctggaaatggcacacaagatcaagactgtgatgtttgataaaactggcaccatcacgtgcggagttcctaaagtcatgagggtgcttttgctgggagacacagctgtgctctctctgaagaaggtactggcggtggttggcactgcagaagccagcagcgagcaccctctaggagtggcagtcactaaatattgcaaagaggagcttggtactcagagcttgggatactgcaccgacttccaggcagtcccaggctgtggcatcagctgcaaagttggaggtgttgaggctatcctggatatggctgaggagggtctcgataagctggacgctaacaggagtggggacagcagtgctcctctgggagataacacactggtcatgctctcagaatcacatggtccaccagtgtctcacacatactcggtgttgattggaaatcgtgagtggatgcgacgcaatggcttgcatattgcaaatgacataaatgatgcaatgacagaccatgaaacaaaaggacagactgctgtactagtggctatcgatggcatgttgtgtggaatgattgcaattgcagacactgttaagcaggaggcagcccttgctgtgcacacgctgaaaaacatgggaatagatgtggtgctgataacgggggacaatagaaaaactgcaaaagccattgctactcaggttgggatcaaaaaagtctttgctgaggttcttccttctcacaaagttgcaaaggtccaggagctccaaaatgggaggatgaaggttgcaatggttggtgatggagtcaatgattctcctgcactagccagggccgacgttggaattgcaattggaacaggcaccgatgttgccattgaagcagccgatgttgttcttatccgaaatgacttgctggatgtagttgccagtattcacttatcaaagagaacagttcgaagaatacgaataaatctggttcttgccttaatttataatctgcttggaatacccatagcagcaggtgtgttcatgcctattggccttgtgcttcagccttggatgggatcagctgcaatggcagcttcttctgtgtctgtcgtgctgtcttccctgcagctgaaatgttataagaagccagacacagaaagttacgaagcacaagctcaaggccacatgaagccacttactccttcccaaatcagtgttcatattggaatggatgataggaggagggattcatccagaccagctccttgggatcagattagccaagtgtctctctcttccttggctgcagacaagctgccgagacataatgggtttgttgaggaggaaggggacaagtggtcattgctcattaatggaagagatgaagaacagtacatctgaagcactgtattcttagtagaggaggaaatattcctccttgctagtgatggcagggaccgacttcatgaagagcttcaaggttgtaaatgaagtcattccttcagctcacaaaacaattgcaagtca

//