2024-04-19 07:29:31, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_030464419 6318 bp mRNA linear VRT 20-AUG-2019 DEFINITION PREDICTED: Calypte anna ATPase copper transporting beta (ATP7B), transcript variant X3, mRNA. ACCESSION XM_030464419 VERSION XM_030464419.1 DBLINK BioProject: PRJNA558503 KEYWORDS RefSeq. SOURCE Calypte anna (Anna's hummingbird) ORGANISM Calypte anna Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Caprimulgimorphae; Apodiformes; Trochilidae; Calypte. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_044244.1) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Calypte anna Annotation Release 101 Annotation Version :: 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..6318 /organism="Calypte anna" /mol_type="mRNA" /isolate="BGI_N300" /db_xref="taxon:9244" /chromosome="1" /sex="female" /country="USA" gene 1..6318 /gene="ATP7B" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 4 ESTs, 9 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:103535568" CDS 142..4434 /gene="ATP7B" /codon_start=1 /product="copper-transporting ATPase 2 isoform X3" /protein_id="XP_030320279.1" /db_xref="GeneID:103535568" /translation="
MKQSFAFDNMGYEESFETLLSPSSQEHTMAVRIVGMTCQSCVQSIEGRISKVEGIVSIKVSLEKNNAVIKYLQSEISPEQICQEIQDMGFDANIAEERLTTETLNASCVREAIVKLRVEGMTCQSCATSIEGKIRKLHGVAKIKVSLGNQEAIIAYYPYIIQPDDLKSHIGNLGYNCTIKSKSAPLKLGVLDLERLQNANPKETAASLKSDGMDPLLAKMSGMATVSVQIEGMHCKSCVRNIEGNISNLPGVQSIKVSLEYKCAVVQYYPNLITLPALQQAIESLPPGNFKVFLHNGSEANKGASPSPALLCDLFREPLQDTASRAVMKIDGMTCNSCVQSIEGTISQRQGVQHIAVSLADRTGTIHYDPAVTNGEELRAAIEDMGFDASVLTDTATGELRHQPDASSAAGQLRPPEPPRPGCVSAGPPDSSPLDEPHQPSGATAEKCFLQITGMTCASCVSTIERNLQKEDGIVSVLVALMAGKAEIKYKPEFIQPLEIAQLIQNLGFEATVIEDHAETEGNVELLITGMTCASCVHNIESKLMRTNGIFYASVALATCKAHIQFDPEITGPRDIIKIIEEIGFHASVARRVPNAHNLDHKKEIQQWRKSFLCSLLFGIPVLILMIYMLIPSGEHHGSMVLEQNLIPGLSILNLLFFVLCTFVQFLGGWYFYVQAYKSLKHKTANMDVLIVMATTIAYVYSCVILMVAIIEKAEESPVTFFDTPPMLFVFIALGRWLEHVAKSKTSEALAKLISLQATEATVVTLGPDHSIIREEQVPVELVQRGDIVKVVPGGKFPVDGKVIEGNSMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVNATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLIAWITIGFMNFDIIKKYFPKQNKHVSKAELILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITCGVPKVMRVLLLGDTAVLSLKKVLAVVGTAEASSEHPLGVAVTKYCKEELGTQSLGYCTDFQAVPGCGISCKVGGVEAFLSTAEEPLDKMDTGRSGGSTAPLGENALITLSESQAPSSPTYSVLIGNREWMRRNGLQIANDINDAMTDHEMKGQTAILVAIDGVLRGMIAVADTVKQEAALAVHTLKNMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNGRSKVAMVGDGVNDSPALARADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLILALIYNLLGIPIAAGVFMPVGLVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDAESYEAQAQGHMKPLSPSQISVHIGMDDRRRDSSRPASWDQISQVSLSSLTSDKLPRCNGFVEEEGDKWSLLMNGGDEEQYI"
misc_feature 232..417 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(247..255,262..264) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 484..675 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(502..510,517..519) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 823..996 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(838..846,853..855) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1120..1311 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1138..1146,1153..1155) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1489..1677 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1504..1512,1519..1521) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1714..1905 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1732..1740,1747..1749) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1969..4107 /gene="ATP7B" /note="P-type heavy metal-transporting ATPase, similar to human copper-transporting ATPases, ATP7A and ATP7B; Region: P-type_ATPase_Cu-like; cd02094" /db_xref="CDD:319783" misc_feature order(2962..2964,2968..2970,4036..4038) /gene="ATP7B" /note="putative Cu binding site [ion binding]; other site" /db_xref="CDD:319783" misc_feature order(3094..3102,3304..3306,3487..3495,3583..3585, 3703..3711,3769..3771,3778..3780,3787..3789,3844..3846, 3853..3855) /gene="ATP7B" /note="putative ATP binding site [chemical binding]; other site" /db_xref="CDD:319783" misc_feature 3094..3114 /gene="ATP7B" /note="P-type ATPase signature motif; other site" /db_xref="CDD:319783" misc_feature 3094..3096 /gene="ATP7B" /note="phosphorylation site [posttranslational modification]" /db_xref="CDD:319783" ORIGIN
cttggctgctcccgggtcatgtttgtgcaaggcagccttggctgagcccccgctacgccgtgcgcaaatctccgcggtgctgaatgcagctgggctttgtccaacacagattctcctcctggctgtgagctggagcctacaatgaaacaaagttttgcatttgacaacatgggctatgaggagagctttgaaactctgctctctccatcttcccaggaacacaccatggcagtcaggattgtgggaatgacttgccagtcatgtgtgcagtcaatagaaggccgaatttccaaggtggaaggcattgtgagcattaaagtctcccttgaaaagaacaatgctgtaattaagtatctgcagtcagaaataagccctgaacagatttgccaggaaattcaggatatgggctttgatgccaacatagcagaagagaggttgactacagagactctaaatgcatcatgtgtgagagaagcaatagttaaacttcgagtagaaggcatgacttgccagtcctgtgccaccagcattgaaggaaagataagaaaacttcatggtgtggcaaaaatcaaggtgtcacttggtaaccaggaagcaattattgcttactacccttacatcattcagcctgatgacctcaagagccatattggtaacctggggtacaactgcaccattaaaagtaaatcagcccctttgaagttgggtgtcctcgacctcgagcgcttgcagaatgcaaaccccaaggagacagcagcaagtctgaagagtgatgggatggatccactccttgccaagatgagtggcatggctacggtgtctgtacagatagaaggcatgcactgcaagtcctgtgtcagaaacattgaaggaaatatatccaatcttcctggcgtacagagtattaaagtgtctttggagtataaatgtgctgtggtacagtattacccaaatttaattaccctgccagctttacagcaagctattgaatctctgccacctggaaactttaaagtattcctccataatggttcagaagcaaataaaggagcatctccatcccctgctttgctatgtgatctcttcagagagccactgcaagacacagcaagcagagctgttatgaagattgatggtatgacctgcaattcttgtgtacagtccatagaagggaccatatcacagagacaaggagtacaacacatagcagtttctctagctgacagaactgggaccatacattatgatccagctgttactaatggagaagaattaagagctgccatagaagacatggggtttgatgcttctgtgctgacagatacagccacaggagaactcagacaccagcctgatgccagcagtgctgccgggcagcttcgacctccagagcctcctcgcccaggctgtgtttcagctggtcctccagacagttctcccctcgatgagccacaccagcccagtggagctacagctgaaaagtgttttttacaaatcacaggcatgacctgtgcatcgtgtgtgtctaccattgaaagaaatttgcagaaggaagacggaattgtttcagtgttggtagcactgatggcaggtaaagcagagataaaatacaagccagaattcatacagcctcttgaaatagcacagctgatccagaacttgggttttgaagctactgtcatagaagatcatgcagaaacagaaggaaatgtggagcttcttattacagggatgacttgtgcttcttgtgttcacaacattgaatccaaactcatgagaacaaatggcatattctacgcttcagttgcacttgctacttgcaaagctcacatccagtttgatcctgaaattactggacctcgagatattataaagataattgaggaaattggttttcatgcttctgtggcaagaagagttccaaatgcacataacttggatcataaaaaggaaatacagcagtggaggaaatctttcctgtgcagcctactgtttggtatccctgtcttaatcctgatgatttatatgctaatacccagtggggaacaccatggctctatggtgctggaacagaatctcattcctggattatctattttaaatcttctcttctttgtcctgtgcacttttgttcagtttcttggtggatggtatttttatgtccaagcttacaaatccctgaagcacaagacagccaatatggatgtgctcattgtaatggccacaacgattgcttatgtgtattcgtgtgtcatcctgatggtagccataattgaaaaggcagaggaaagccctgtcactttctttgacactcctccaatgctgtttgtgttcattgcccttgggagatggttggaacacgttgcaaagagtaagacctcagaggctcttgctaaacttatatctcttcaagccacagaagccactgtggtgactcttggacctgaccactctatcatcagggaggagcaggtgcctgttgaactggttcagaggggtgatattgtaaaggttgttcctggtggaaaattcccagtggatggaaaagtcatcgaagggaattctatggcagatgagtctctcattactggggaagctatgccagtcactaaaaagcctgggagcacagtaattgctggttctataaatgcacatggctcagttcttgttaatgcaactcatgttggtaatgataccactctggcacaaatcgtgaaattggtggaagaagctcaaatgtcaaaggcacccatccagcaactggcagataagtttagtggatattttgttccatttatcatcatcatttcaacagtgacattgatagcatggatcacgattggttttatgaattttgatattatcaaaaaatattttcctaagcagaacaagcacgtttcaaaagctgagctaatcctgaggtttgcatttcaaacctcaatcactgtgctgagcattgcatgtccctgttccttaggcttggccacccccacagctgtgatggtgggcacaggagttgctgctcagaatgggattctaatcaaaggtggaaaacccctggaaatggcacacaagatcaagactgtgatgtttgataagactgggacgatcacctgtggggttcctaaagtcatgagggtgcttttgctgggagatacagccgtgctctctctgaagaaggtgctggcagtggttggcactgcagaagccagcagcgagcatcctttaggagtagcagtcactaagtactgcaaagaggagcttggcactcagagcctgggatactgcactgacttccaggcagtcccaggctgtggcatcagctgcaaagtcgggggtgttgaggctttcctgagcacagctgaggagcccctggataagatggatactggcaggagtggggggagcactgctcctctgggagagaacgccctgatcacgctctccgaatcacaggctccatcatctcctacgtactcggtgctgattggaaaccgggagtggatgcgacgcaacggtttgcagattgcaaatgacatcaacgatgcaatgacagaccatgagatgaaaggacagactgccatactggtggctatagatggtgtgttgcgtggaatgattgcagtggcagacactgtcaagcaggaggcagcccttgctgtgcacacgctgaaaaacatgggaattgatgtggtgctgataactggggataacagaaaaactgcaaaagccattgctactcaggttgggatcaaaaaagtctttgctgaggtccttccttctcacaaggttgcgaaggtccaggagctccaaaatgggagaagtaaagttgcaatggttggtgatggagtcaatgattcccctgcactggccagggctgatgttggaattgcaattggaacgggcactgatgttgccattgaagcagcagatgtggttctaatccgaaatgacttgctggatgtagttgccagtattcacttatcaaagagaacagttcgaagaatacgaataaatctgattcttgccctaatttataatctgcttggaatacccatagcagcaggtgtgttcatgcctgttggccttgtgcttcagccttggatgggatcagctgcaatggcagcttcttctgtgtctgtggtgctttcttccctgcagctgaaatgttataagaagccagatgcagaaagttatgaagcacaagctcaaggccacatgaagccactttctccttcccaaatcagtgttcatattggaatggatgacaggaggagggactcatccagaccagcttcttgggatcagattagccaggtgtctctctcttccttgacttcagacaagctgccaagatgtaatggttttgttgaggaggaaggggacaaatggtcactgctcatgaatggaggagatgaagaacagtacatctgaagcactgtattcttagtacagcaggaaacattcctccccagaggcggagggggggaatgagttaagacaccaagagattcaggattgctagtgaagtcattccttcacttacacaacaactgcaactcagtttgttgttgggttgtagggactgcggattttttcaactcaccagttatttctagtcatggaaagaatctgtggttctataataaaatggcttcttcatacacaataattaatgaaataatgttaaactgtaattttcgttgtctaaaagagtttctctcctctggattgtttgctgggtacccagtttcatacttttgactcttttttactttattctttcaaaaacacatgaagcaaaggtatttatagagctgtcaaatattcatttctgtgcctaagtgaaaatacccatggcataagcatctcagtggtcacaaattatatttttacataaatgctaaatagccacatcactgtgagagcactttgtatttacgattcatgtgcatctcctggaccaaaaatgcttcagtgtttcactgactataactttctgaaaggtctctttcaaagattttcacttgatttcaggtatgtcttttgatgcacatttccatgactaaacttgtctgttattttcattttctcctatattttctctcttgttccatatgagctttcccccccttttctttgcacagggtatcttctctgatattactctgagatattactatgtttacagatattcctgtctggggcaaactcctttaaattaccagggacttttctgttcttattgaagttcaaagacagcagttcctggtccatatcatttttaatatggatgccttgcaggactccacgaagctcctgacaattctgtagtcatctgtcttttcctctgacagagtgaagaatttctctcagtgtgagtgagtgaggtatttccctggtgtgagtgagagcaggactagcactggtgtgactccagtgtggctgaatggagtgagtttattgcttaagttaaccccagcttgctggttgcttaaaatggagccaaaagtttaaatggtaaaggtgggaaagtggccttaaaatgtgtggtttctgtttgctatcctataaggaaccttttctgatgagagaaggactggaactaatatttgtaatagcttgaatgttaaggtgaatttctattcatgttttgaattggttttgatttccctctttgtttcatgaggaatcaaggtgctgaacaacccttttttcactttaatgtctaccaaagcctgccagtaactctgtcactatgaatgtcaaatttatcccttaaccctttttagccagaacagtaggaatcaaaaactttggtgctctgaatctgcttccttgtgctcccattgctcagccagggacctccaaatcaagcagactgaagttttatgatctaatctaaaaagtgagaagtgaaagagcaagaattaccatgctgaacaacatgaaataactacttattttcactgacttaaatacaggactgtttccaacatgggttcaaattctgcccctcctcatgcaaaaatgaaaactgagtcagagagccaaagaactgtgctaaagcattgagcaagtcttcctattctctcttcctctgaatattatatttgacctttccttagcaaacatcagcagcactaacttaagtataattgtgaatcagttttaaaactgtgaaacctctttgcttgtggagagattactctcacagcacactcacttctcagacatggggaagattgtctactgtctgactgttttatgttttcttaccagtgcatacagtaaaaatattgtgtttttaaaaacaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]