LOCUS       XM_030464410            6471 bp    mRNA    linear   VRT 20-AUG-2019
DEFINITION  PREDICTED: Calypte anna ATPase copper transporting beta (ATP7B),
            transcript variant X2, mRNA.
ACCESSION   XM_030464410
VERSION     XM_030464410.1
DBLINK      BioProject: PRJNA558503
KEYWORDS    RefSeq.
SOURCE      Calypte anna (Anna's hummingbird)
  ORGANISM  Calypte anna
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Neoaves; Strisores; Apodiformes;
            Trochilidae; Calypte.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_044244.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Calypte anna Annotation Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..6471
                     /organism="Calypte anna"
                     /mol_type="mRNA"
                     /isolate="BGI_N300"
                     /db_xref="taxon:9244"
                     /chromosome="1"
                     /sex="female"
                     /geo_loc_name="USA"
     gene            1..6471
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 4 ESTs, 8 Proteins, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 1 sample with support for all
                     annotated introns"
                     /db_xref="GeneID:103535568"
     CDS             211..4587
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X2"
                     /protein_id="XP_030320270.1"
                     /db_xref="GeneID:103535568"
                     /translation="

MGMPEVNAVERQALSNTDSPPGCELEPTMKQSFAFDNMGYEESFETLLSPSSQEHTMAVRIVGMTCQSCVQSIEGRISKVEGIVSIKVSLEKNNAVIKYLQSEISPEQICQEIQDMGFDANIAEERLTTETLNASCVREAIVKLRVEGMTCQSCATSIEGKIRKLHGVAKIKVSLGNQEAIIAYYPYIIQPDDLKSHIGNLGYNCTIKSKSAPLKLGVLDLERLQNANPKETAASLKSDGMDPLLAKMSGMATVSVQIEGMHCKSCVRNIEGNISNLPGVQSIKVSLEYKCAVVQYYPNLITLPALQQAIESLPPGNFKVFLHNGSEANKGASPSPALLCDLFREPLQDTASRAVMKIDGMTCNSCVQSIEGTISQRQGVQHIAVSLADRTGTIHYDPAVTNGEELRAAIEDMGFDASVLTDTATGELRHQPDASSAAGQLRPPEPPRPGCVSAGPPDSSPLDEPHQPSGATAEKCFLQITGMTCASCVSTIERNLQKEDGIVSVLVALMAGKAEIKYKPEFIQPLEIAQLIQNLGFEATVIEDHAETEGNVELLITGMTCASCVHNIESKLMRTNGIFYASVALATCKAHIQFDPEITGPRDIIKIIEEIGFHASVARRVPNAHNLDHKKEIQQWRKSFLCSLLFGIPVLILMIYMLIPSGEHHGSMVLEQNLIPGLSILNLLFFVLCTFVQFLGGWYFYVQAYKSLKHKTANMDVLIVMATTIAYVYSCVILMVAIIEKAEESPVTFFDTPPMLFVFIALGRWLEHVAKSKTSEALAKLISLQATEATVVTLGPDHSIIREEQVPVELVQRGDIVKVVPGGKFPVDGKVIEGNSMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVNATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLIAWITIGFMNFDIIKKYFPKQNKHVSKAELILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITCGVPKVMRVLLLGDTAVLSLKKVLAVVGTAEASSEHPLGVAVTKYCKEELGTQSLGYCTDFQAVPGCGISCKVGGVEAFLSTAEEPLDKMDTGRSGGSTAPLGENALITLSESQAPSSPTYSVLIGNREWMRRNGLQIANDINDAMTDHEMKGQTAILVAIDGVLRGMIAVADTVKQEAALAVHTLKNMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNGRSKVAMVGDGVNDSPALARADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLILALIYNLLGIPIAAGVFMPVGLVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDAESYEAQAQGHMKPLSPSQISVHIGMDDRRRDSSRPASWDQISQVSLSSLTSDKLPRCNGFVEEEGDKWSLLMNGGDEEQYI"

     misc_feature    385..570
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(400..408,415..417)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    637..828
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(655..663,670..672)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    976..1149
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(991..999,1006..1008)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1267..1473
                     /gene="ATP7B"
                     /note="Copper chaperone CopZ [Inorganic ion transport and
                     metabolism]; Region: CopZ; COG2608"
                     /db_xref="CDD:442020"
     misc_feature    1642..1830
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1657..1665,1672..1674)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1867..2058
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1885..1893,1900..1902)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2122..4260
                     /gene="ATP7B"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(3115..3117,3121..3123,4189..4191)
                     /gene="ATP7B"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(3247..3255,3457..3459,3640..3648,3736..3738,
                     3856..3864,3922..3924,3931..3933,3940..3942,3997..3999,
                     4006..4008)
                     /gene="ATP7B"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      

cttggctgctcccgggtcatgtttgtgcaaggcagccttggctgagcccccgctacgccgtgcgcaaatctccgcggtgctgaatgcagctggcaggcagctcatgatgtgcctgaactactgattattggtgaaaagtccaaggcagaatctccggtaaaagcatccagtaactcgcagaaagaagagaaacttttgcagagttactccatgggaatgccagaagtcaatgcagttgaaagacaggctttgtccaacacagattctcctcctggctgtgagctggagcctacaatgaaacaaagttttgcatttgacaacatgggctatgaggagagctttgaaactctgctctctccatcttcccaggaacacaccatggcagtcaggattgtgggaatgacttgccagtcatgtgtgcagtcaatagaaggccgaatttccaaggtggaaggcattgtgagcattaaagtctcccttgaaaagaacaatgctgtaattaagtatctgcagtcagaaataagccctgaacagatttgccaggaaattcaggatatgggctttgatgccaacatagcagaagagaggttgactacagagactctaaatgcatcatgtgtgagagaagcaatagttaaacttcgagtagaaggcatgacttgccagtcctgtgccaccagcattgaaggaaagataagaaaacttcatggtgtggcaaaaatcaaggtgtcacttggtaaccaggaagcaattattgcttactacccttacatcattcagcctgatgacctcaagagccatattggtaacctggggtacaactgcaccattaaaagtaaatcagcccctttgaagttgggtgtcctcgacctcgagcgcttgcagaatgcaaaccccaaggagacagcagcaagtctgaagagtgatgggatggatccactccttgccaagatgagtggcatggctacggtgtctgtacagatagaaggcatgcactgcaagtcctgtgtcagaaacattgaaggaaatatatccaatcttcctggcgtacagagtattaaagtgtctttggagtataaatgtgctgtggtacagtattacccaaatttaattaccctgccagctttacagcaagctattgaatctctgccacctggaaactttaaagtattcctccataatggttcagaagcaaataaaggagcatctccatcccctgctttgctatgtgatctcttcagagagccactgcaagacacagcaagcagagctgttatgaagattgatggtatgacctgcaattcttgtgtacagtccatagaagggaccatatcacagagacaaggagtacaacacatagcagtttctctagctgacagaactgggaccatacattatgatccagctgttactaatggagaagaattaagagctgccatagaagacatggggtttgatgcttctgtgctgacagatacagccacaggagaactcagacaccagcctgatgccagcagtgctgccgggcagcttcgacctccagagcctcctcgcccaggctgtgtttcagctggtcctccagacagttctcccctcgatgagccacaccagcccagtggagctacagctgaaaagtgttttttacaaatcacaggcatgacctgtgcatcgtgtgtgtctaccattgaaagaaatttgcagaaggaagacggaattgtttcagtgttggtagcactgatggcaggtaaagcagagataaaatacaagccagaattcatacagcctcttgaaatagcacagctgatccagaacttgggttttgaagctactgtcatagaagatcatgcagaaacagaaggaaatgtggagcttcttattacagggatgacttgtgcttcttgtgttcacaacattgaatccaaactcatgagaacaaatggcatattctacgcttcagttgcacttgctacttgcaaagctcacatccagtttgatcctgaaattactggacctcgagatattataaagataattgaggaaattggttttcatgcttctgtggcaagaagagttccaaatgcacataacttggatcataaaaaggaaatacagcagtggaggaaatctttcctgtgcagcctactgtttggtatccctgtcttaatcctgatgatttatatgctaatacccagtggggaacaccatggctctatggtgctggaacagaatctcattcctggattatctattttaaatcttctcttctttgtcctgtgcacttttgttcagtttcttggtggatggtatttttatgtccaagcttacaaatccctgaagcacaagacagccaatatggatgtgctcattgtaatggccacaacgattgcttatgtgtattcgtgtgtcatcctgatggtagccataattgaaaaggcagaggaaagccctgtcactttctttgacactcctccaatgctgtttgtgttcattgcccttgggagatggttggaacacgttgcaaagagtaagacctcagaggctcttgctaaacttatatctcttcaagccacagaagccactgtggtgactcttggacctgaccactctatcatcagggaggagcaggtgcctgttgaactggttcagaggggtgatattgtaaaggttgttcctggtggaaaattcccagtggatggaaaagtcatcgaagggaattctatggcagatgagtctctcattactggggaagctatgccagtcactaaaaagcctgggagcacagtaattgctggttctataaatgcacatggctcagttcttgttaatgcaactcatgttggtaatgataccactctggcacaaatcgtgaaattggtggaagaagctcaaatgtcaaaggcacccatccagcaactggcagataagtttagtggatattttgttccatttatcatcatcatttcaacagtgacattgatagcatggatcacgattggttttatgaattttgatattatcaaaaaatattttcctaagcagaacaagcacgtttcaaaagctgagctaatcctgaggtttgcatttcaaacctcaatcactgtgctgagcattgcatgtccctgttccttaggcttggccacccccacagctgtgatggtgggcacaggagttgctgctcagaatgggattctaatcaaaggtggaaaacccctggaaatggcacacaagatcaagactgtgatgtttgataagactgggacgatcacctgtggggttcctaaagtcatgagggtgcttttgctgggagatacagccgtgctctctctgaagaaggtgctggcagtggttggcactgcagaagccagcagcgagcatcctttaggagtagcagtcactaagtactgcaaagaggagcttggcactcagagcctgggatactgcactgacttccaggcagtcccaggctgtggcatcagctgcaaagtcgggggtgttgaggctttcctgagcacagctgaggagcccctggataagatggatactggcaggagtggggggagcactgctcctctgggagagaacgccctgatcacgctctccgaatcacaggctccatcatctcctacgtactcggtgctgattggaaaccgggagtggatgcgacgcaacggtttgcagattgcaaatgacatcaacgatgcaatgacagaccatgagatgaaaggacagactgccatactggtggctatagatggtgtgttgcgtggaatgattgcagtggcagacactgtcaagcaggaggcagcccttgctgtgcacacgctgaaaaacatgggaattgatgtggtgctgataactggggataacagaaaaactgcaaaagccattgctactcaggttgggatcaaaaaagtctttgctgaggtccttccttctcacaaggttgcgaaggtccaggagctccaaaatgggagaagtaaagttgcaatggttggtgatggagtcaatgattcccctgcactggccagggctgatgttggaattgcaattggaacgggcactgatgttgccattgaagcagcagatgtggttctaatccgaaatgacttgctggatgtagttgccagtattcacttatcaaagagaacagttcgaagaatacgaataaatctgattcttgccctaatttataatctgcttggaatacccatagcagcaggtgtgttcatgcctgttggccttgtgcttcagccttggatgggatcagctgcaatggcagcttcttctgtgtctgtggtgctttcttccctgcagctgaaatgttataagaagccagatgcagaaagttatgaagcacaagctcaaggccacatgaagccactttctccttcccaaatcagtgttcatattggaatggatgacaggaggagggactcatccagaccagcttcttgggatcagattagccaggtgtctctctcttccttgacttcagacaagctgccaagatgtaatggttttgttgaggaggaaggggacaaatggtcactgctcatgaatggaggagatgaagaacagtacatctgaagcactgtattcttagtacagcaggaaacattcctccccagaggcggagggggggaatgagttaagacaccaagagattcaggattgctagtgaagtcattccttcacttacacaacaactgcaactcagtttgttgttgggttgtagggactgcggattttttcaactcaccagttatttctagtcatggaaagaatctgtggttctataataaaatggcttcttcatacacaataattaatgaaataatgttaaactgtaattttcgttgtctaaaagagtttctctcctctggattgtttgctgggtacccagtttcatacttttgactcttttttactttattctttcaaaaacacatgaagcaaaggtatttatagagctgtcaaatattcatttctgtgcctaagtgaaaatacccatggcataagcatctcagtggtcacaaattatatttttacataaatgctaaatagccacatcactgtgagagcactttgtatttacgattcatgtgcatctcctggaccaaaaatgcttcagtgtttcactgactataactttctgaaaggtctctttcaaagattttcacttgatttcaggtatgtcttttgatgcacatttccatgactaaacttgtctgttattttcattttctcctatattttctctcttgttccatatgagctttcccccccttttctttgcacagggtatcttctctgatattactctgagatattactatgtttacagatattcctgtctggggcaaactcctttaaattaccagggacttttctgttcttattgaagttcaaagacagcagttcctggtccatatcatttttaatatggatgccttgcaggactccacgaagctcctgacaattctgtagtcatctgtcttttcctctgacagagtgaagaatttctctcagtgtgagtgagtgaggtatttccctggtgtgagtgagagcaggactagcactggtgtgactccagtgtggctgaatggagtgagtttattgcttaagttaaccccagcttgctggttgcttaaaatggagccaaaagtttaaatggtaaaggtgggaaagtggccttaaaatgtgtggtttctgtttgctatcctataaggaaccttttctgatgagagaaggactggaactaatatttgtaatagcttgaatgttaaggtgaatttctattcatgttttgaattggttttgatttccctctttgtttcatgaggaatcaaggtgctgaacaacccttttttcactttaatgtctaccaaagcctgccagtaactctgtcactatgaatgtcaaatttatcccttaaccctttttagccagaacagtaggaatcaaaaactttggtgctctgaatctgcttccttgtgctcccattgctcagccagggacctccaaatcaagcagactgaagttttatgatctaatctaaaaagtgagaagtgaaagagcaagaattaccatgctgaacaacatgaaataactacttattttcactgacttaaatacaggactgtttccaacatgggttcaaattctgcccctcctcatgcaaaaatgaaaactgagtcagagagccaaagaactgtgctaaagcattgagcaagtcttcctattctctcttcctctgaatattatatttgacctttccttagcaaacatcagcagcactaacttaagtataattgtgaatcagttttaaaactgtgaaacctctttgcttgtggagagattactctcacagcacactcacttctcagacatggggaagattgtctactgtctgactgttttatgttttcttaccagtgcatacagtaaaaatattgtgtttttaaaaacaaa

//