ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2025-10-30 22:35:38, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS XM_030464403 6602 bp mRNA linear VRT 20-AUG-2019
DEFINITION PREDICTED: Calypte anna ATPase copper transporting beta (ATP7B),
transcript variant X1, mRNA.
ACCESSION XM_030464403
VERSION XM_030464403.1
DBLINK BioProject: PRJNA558503
KEYWORDS RefSeq.
SOURCE Calypte anna (Anna's hummingbird)
ORGANISM Calypte anna
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
Coelurosauria; Aves; Neognathae; Neoaves; Strisores; Apodiformes;
Trochilidae; Calypte.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NC_044244.1) annotated using gene prediction method: Gnomon,
supported by EST evidence.
Also see:
Documentation of NCBI's Annotation Process
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI
Annotation Status :: Full annotation
Annotation Name :: Calypte anna Annotation Release 101
Annotation Version :: 101
Annotation Pipeline :: NCBI eukaryotic genome annotation
pipeline
Annotation Software Version :: 8.2
Annotation Method :: Best-placed RefSeq; Gnomon
Features Annotated :: Gene; mRNA; CDS; ncRNA
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..6602
/organism="Calypte anna"
/mol_type="mRNA"
/isolate="BGI_N300"
/db_xref="taxon:9244"
/chromosome="1"
/sex="female"
/geo_loc_name="USA"
gene 1..6602
/gene="ATP7B"
/note="Derived by automated computational analysis using
gene prediction method: Gnomon. Supporting evidence
includes similarity to: 4 ESTs, 9 Proteins, and 100%
coverage of the annotated genomic feature by RNAseq
alignments, including 2 samples with support for all
annotated introns"
/db_xref="GeneID:103535568"
CDS 123..4718
/gene="ATP7B"
/codon_start=1
/product="copper-transporting ATPase 2 isoform X1"
/protein_id="XP_030320263.1"
/db_xref="GeneID:103535568"
/translation="
MIMERKLDNKMKSEVSCLATLNNKNITLVSIRKQQAAHDVPELLIIGEKSKAESPVKASSNSQKEEKLLQSYSMGMPEVNAVERQALSNTDSPPGCELEPTMKQSFAFDNMGYEESFETLLSPSSQEHTMAVRIVGMTCQSCVQSIEGRISKVEGIVSIKVSLEKNNAVIKYLQSEISPEQICQEIQDMGFDANIAEERLTTETLNASCVREAIVKLRVEGMTCQSCATSIEGKIRKLHGVAKIKVSLGNQEAIIAYYPYIIQPDDLKSHIGNLGYNCTIKSKSAPLKLGVLDLERLQNANPKETAASLKSDGMDPLLAKMSGMATVSVQIEGMHCKSCVRNIEGNISNLPGVQSIKVSLEYKCAVVQYYPNLITLPALQQAIESLPPGNFKVFLHNGSEANKGASPSPALLCDLFREPLQDTASRAVMKIDGMTCNSCVQSIEGTISQRQGVQHIAVSLADRTGTIHYDPAVTNGEELRAAIEDMGFDASVLTDTATGELRHQPDASSAAGQLRPPEPPRPGCVSAGPPDSSPLDEPHQPSGATAEKCFLQITGMTCASCVSTIERNLQKEDGIVSVLVALMAGKAEIKYKPEFIQPLEIAQLIQNLGFEATVIEDHAETEGNVELLITGMTCASCVHNIESKLMRTNGIFYASVALATCKAHIQFDPEITGPRDIIKIIEEIGFHASVARRVPNAHNLDHKKEIQQWRKSFLCSLLFGIPVLILMIYMLIPSGEHHGSMVLEQNLIPGLSILNLLFFVLCTFVQFLGGWYFYVQAYKSLKHKTANMDVLIVMATTIAYVYSCVILMVAIIEKAEESPVTFFDTPPMLFVFIALGRWLEHVAKSKTSEALAKLISLQATEATVVTLGPDHSIIREEQVPVELVQRGDIVKVVPGGKFPVDGKVIEGNSMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVNATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLIAWITIGFMNFDIIKKYFPKQNKHVSKAELILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITCGVPKVMRVLLLGDTAVLSLKKVLAVVGTAEASSEHPLGVAVTKYCKEELGTQSLGYCTDFQAVPGCGISCKVGGVEAFLSTAEEPLDKMDTGRSGGSTAPLGENALITLSESQAPSSPTYSVLIGNREWMRRNGLQIANDINDAMTDHEMKGQTAILVAIDGVLRGMIAVADTVKQEAALAVHTLKNMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNGRSKVAMVGDGVNDSPALARADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLILALIYNLLGIPIAAGVFMPVGLVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDAESYEAQAQGHMKPLSPSQISVHIGMDDRRRDSSRPASWDQISQVSLSSLTSDKLPRCNGFVEEEGDKWSLLMNGGDEEQYI"
misc_feature 516..701
/gene="ATP7B"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(531..539,546..548)
/gene="ATP7B"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 768..959
/gene="ATP7B"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(786..794,801..803)
/gene="ATP7B"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 1107..1280
/gene="ATP7B"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(1122..1130,1137..1139)
/gene="ATP7B"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 1398..1604
/gene="ATP7B"
/note="Copper chaperone CopZ [Inorganic ion transport and
metabolism]; Region: CopZ; COG2608"
/db_xref="CDD:442020"
misc_feature 1773..1961
/gene="ATP7B"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(1788..1796,1803..1805)
/gene="ATP7B"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 1998..2189
/gene="ATP7B"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(2016..2024,2031..2033)
/gene="ATP7B"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 2253..4391
/gene="ATP7B"
/note="P-type heavy metal-transporting ATPase, similar to
human copper-transporting ATPases, ATP7A and ATP7B;
Region: P-type_ATPase_Cu-like; cd02094"
/db_xref="CDD:319783"
misc_feature order(3246..3248,3252..3254,4320..4322)
/gene="ATP7B"
/note="putative Cu binding site [ion binding]; other site"
/db_xref="CDD:319783"
misc_feature order(3378..3386,3588..3590,3771..3779,3867..3869,
3987..3995,4053..4055,4062..4064,4071..4073,4128..4130,
4137..4139)
/gene="ATP7B"
/note="putative ATP binding site [chemical binding]; other
site"
/db_xref="CDD:319783"
ORIGIN
tggctgatgagcaccttgggtaaatgggcagaactctccgagctgcaagaagagtgtgggggtgataaggcactaagtaactgctctgagaaagctctcctttggtgatatttaaggctggaatgataatggagagaaaactggacaataaaatgaaaagcgaagtgtcctgcttagctactttgaacaacaaaaacataaccctggtgtctattcgtaagcagcaggcagctcatgatgtgcctgaactactgattattggtgaaaagtccaaggcagaatctccggtaaaagcatccagtaactcgcagaaagaagagaaacttttgcagagttactccatgggaatgccagaagtcaatgcagttgaaagacaggctttgtccaacacagattctcctcctggctgtgagctggagcctacaatgaaacaaagttttgcatttgacaacatgggctatgaggagagctttgaaactctgctctctccatcttcccaggaacacaccatggcagtcaggattgtgggaatgacttgccagtcatgtgtgcagtcaatagaaggccgaatttccaaggtggaaggcattgtgagcattaaagtctcccttgaaaagaacaatgctgtaattaagtatctgcagtcagaaataagccctgaacagatttgccaggaaattcaggatatgggctttgatgccaacatagcagaagagaggttgactacagagactctaaatgcatcatgtgtgagagaagcaatagttaaacttcgagtagaaggcatgacttgccagtcctgtgccaccagcattgaaggaaagataagaaaacttcatggtgtggcaaaaatcaaggtgtcacttggtaaccaggaagcaattattgcttactacccttacatcattcagcctgatgacctcaagagccatattggtaacctggggtacaactgcaccattaaaagtaaatcagcccctttgaagttgggtgtcctcgacctcgagcgcttgcagaatgcaaaccccaaggagacagcagcaagtctgaagagtgatgggatggatccactccttgccaagatgagtggcatggctacggtgtctgtacagatagaaggcatgcactgcaagtcctgtgtcagaaacattgaaggaaatatatccaatcttcctggcgtacagagtattaaagtgtctttggagtataaatgtgctgtggtacagtattacccaaatttaattaccctgccagctttacagcaagctattgaatctctgccacctggaaactttaaagtattcctccataatggttcagaagcaaataaaggagcatctccatcccctgctttgctatgtgatctcttcagagagccactgcaagacacagcaagcagagctgttatgaagattgatggtatgacctgcaattcttgtgtacagtccatagaagggaccatatcacagagacaaggagtacaacacatagcagtttctctagctgacagaactgggaccatacattatgatccagctgttactaatggagaagaattaagagctgccatagaagacatggggtttgatgcttctgtgctgacagatacagccacaggagaactcagacaccagcctgatgccagcagtgctgccgggcagcttcgacctccagagcctcctcgcccaggctgtgtttcagctggtcctccagacagttctcccctcgatgagccacaccagcccagtggagctacagctgaaaagtgttttttacaaatcacaggcatgacctgtgcatcgtgtgtgtctaccattgaaagaaatttgcagaaggaagacggaattgtttcagtgttggtagcactgatggcaggtaaagcagagataaaatacaagccagaattcatacagcctcttgaaatagcacagctgatccagaacttgggttttgaagctactgtcatagaagatcatgcagaaacagaaggaaatgtggagcttcttattacagggatgacttgtgcttcttgtgttcacaacattgaatccaaactcatgagaacaaatggcatattctacgcttcagttgcacttgctacttgcaaagctcacatccagtttgatcctgaaattactggacctcgagatattataaagataattgaggaaattggttttcatgcttctgtggcaagaagagttccaaatgcacataacttggatcataaaaaggaaatacagcagtggaggaaatctttcctgtgcagcctactgtttggtatccctgtcttaatcctgatgatttatatgctaatacccagtggggaacaccatggctctatggtgctggaacagaatctcattcctggattatctattttaaatcttctcttctttgtcctgtgcacttttgttcagtttcttggtggatggtatttttatgtccaagcttacaaatccctgaagcacaagacagccaatatggatgtgctcattgtaatggccacaacgattgcttatgtgtattcgtgtgtcatcctgatggtagccataattgaaaaggcagaggaaagccctgtcactttctttgacactcctccaatgctgtttgtgttcattgcccttgggagatggttggaacacgttgcaaagagtaagacctcagaggctcttgctaaacttatatctcttcaagccacagaagccactgtggtgactcttggacctgaccactctatcatcagggaggagcaggtgcctgttgaactggttcagaggggtgatattgtaaaggttgttcctggtggaaaattcccagtggatggaaaagtcatcgaagggaattctatggcagatgagtctctcattactggggaagctatgccagtcactaaaaagcctgggagcacagtaattgctggttctataaatgcacatggctcagttcttgttaatgcaactcatgttggtaatgataccactctggcacaaatcgtgaaattggtggaagaagctcaaatgtcaaaggcacccatccagcaactggcagataagtttagtggatattttgttccatttatcatcatcatttcaacagtgacattgatagcatggatcacgattggttttatgaattttgatattatcaaaaaatattttcctaagcagaacaagcacgtttcaaaagctgagctaatcctgaggtttgcatttcaaacctcaatcactgtgctgagcattgcatgtccctgttccttaggcttggccacccccacagctgtgatggtgggcacaggagttgctgctcagaatgggattctaatcaaaggtggaaaacccctggaaatggcacacaagatcaagactgtgatgtttgataagactgggacgatcacctgtggggttcctaaagtcatgagggtgcttttgctgggagatacagccgtgctctctctgaagaaggtgctggcagtggttggcactgcagaagccagcagcgagcatcctttaggagtagcagtcactaagtactgcaaagaggagcttggcactcagagcctgggatactgcactgacttccaggcagtcccaggctgtggcatcagctgcaaagtcgggggtgttgaggctttcctgagcacagctgaggagcccctggataagatggatactggcaggagtggggggagcactgctcctctgggagagaacgccctgatcacgctctccgaatcacaggctccatcatctcctacgtactcggtgctgattggaaaccgggagtggatgcgacgcaacggtttgcagattgcaaatgacatcaacgatgcaatgacagaccatgagatgaaaggacagactgccatactggtggctatagatggtgtgttgcgtggaatgattgcagtggcagacactgtcaagcaggaggcagcccttgctgtgcacacgctgaaaaacatgggaattgatgtggtgctgataactggggataacagaaaaactgcaaaagccattgctactcaggttgggatcaaaaaagtctttgctgaggtccttccttctcacaaggttgcgaaggtccaggagctccaaaatgggagaagtaaagttgcaatggttggtgatggagtcaatgattcccctgcactggccagggctgatgttggaattgcaattggaacgggcactgatgttgccattgaagcagcagatgtggttctaatccgaaatgacttgctggatgtagttgccagtattcacttatcaaagagaacagttcgaagaatacgaataaatctgattcttgccctaatttataatctgcttggaatacccatagcagcaggtgtgttcatgcctgttggccttgtgcttcagccttggatgggatcagctgcaatggcagcttcttctgtgtctgtggtgctttcttccctgcagctgaaatgttataagaagccagatgcagaaagttatgaagcacaagctcaaggccacatgaagccactttctccttcccaaatcagtgttcatattggaatggatgacaggaggagggactcatccagaccagcttcttgggatcagattagccaggtgtctctctcttccttgacttcagacaagctgccaagatgtaatggttttgttgaggaggaaggggacaaatggtcactgctcatgaatggaggagatgaagaacagtacatctgaagcactgtattcttagtacagcaggaaacattcctccccagaggcggagggggggaatgagttaagacaccaagagattcaggattgctagtgaagtcattccttcacttacacaacaactgcaactcagtttgttgttgggttgtagggactgcggattttttcaactcaccagttatttctagtcatggaaagaatctgtggttctataataaaatggcttcttcatacacaataattaatgaaataatgttaaactgtaattttcgttgtctaaaagagtttctctcctctggattgtttgctgggtacccagtttcatacttttgactcttttttactttattctttcaaaaacacatgaagcaaaggtatttatagagctgtcaaatattcatttctgtgcctaagtgaaaatacccatggcataagcatctcagtggtcacaaattatatttttacataaatgctaaatagccacatcactgtgagagcactttgtatttacgattcatgtgcatctcctggaccaaaaatgcttcagtgtttcactgactataactttctgaaaggtctctttcaaagattttcacttgatttcaggtatgtcttttgatgcacatttccatgactaaacttgtctgttattttcattttctcctatattttctctcttgttccatatgagctttcccccccttttctttgcacagggtatcttctctgatattactctgagatattactatgtttacagatattcctgtctggggcaaactcctttaaattaccagggacttttctgttcttattgaagttcaaagacagcagttcctggtccatatcatttttaatatggatgccttgcaggactccacgaagctcctgacaattctgtagtcatctgtcttttcctctgacagagtgaagaatttctctcagtgtgagtgagtgaggtatttccctggtgtgagtgagagcaggactagcactggtgtgactccagtgtggctgaatggagtgagtttattgcttaagttaaccccagcttgctggttgcttaaaatggagccaaaagtttaaatggtaaaggtgggaaagtggccttaaaatgtgtggtttctgtttgctatcctataaggaaccttttctgatgagagaaggactggaactaatatttgtaatagcttgaatgttaaggtgaatttctattcatgttttgaattggttttgatttccctctttgtttcatgaggaatcaaggtgctgaacaacccttttttcactttaatgtctaccaaagcctgccagtaactctgtcactatgaatgtcaaatttatcccttaaccctttttagccagaacagtaggaatcaaaaactttggtgctctgaatctgcttccttgtgctcccattgctcagccagggacctccaaatcaagcagactgaagttttatgatctaatctaaaaagtgagaagtgaaagagcaagaattaccatgctgaacaacatgaaataactacttattttcactgacttaaatacaggactgtttccaacatgggttcaaattctgcccctcctcatgcaaaaatgaaaactgagtcagagagccaaagaactgtgctaaagcattgagcaagtcttcctattctctcttcctctgaatattatatttgacctttccttagcaaacatcagcagcactaacttaagtataattgtgaatcagttttaaaactgtgaaacctctttgcttgtggagagattactctcacagcacactcacttctcagacatggggaagattgtctactgtctgactgttttatgttttcttaccagtgcatacagtaaaaatattgtgtttttaaaaacaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]