GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-09-28 17:55:52, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       XM_030464403            6602 bp    mRNA    linear   VRT 20-AUG-2019
DEFINITION  PREDICTED: Calypte anna ATPase copper transporting beta (ATP7B),
            transcript variant X1, mRNA.
ACCESSION   XM_030464403
VERSION     XM_030464403.1
DBLINK      BioProject: PRJNA558503
KEYWORDS    RefSeq.
SOURCE      Calypte anna (Anna's hummingbird)
  ORGANISM  Calypte anna
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Neoaves; Strisores; Apodiformes;
            Trochilidae; Calypte.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_044244.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Calypte anna Annotation Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..6602
                     /organism="Calypte anna"
                     /mol_type="mRNA"
                     /isolate="BGI_N300"
                     /db_xref="taxon:9244"
                     /chromosome="1"
                     /sex="female"
                     /geo_loc_name="USA"
     gene            1..6602
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 4 ESTs, 9 Proteins, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 2 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:103535568"
     CDS             123..4718
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X1"
                     /protein_id="XP_030320263.1"
                     /db_xref="GeneID:103535568"
                     /translation="
MIMERKLDNKMKSEVSCLATLNNKNITLVSIRKQQAAHDVPELLIIGEKSKAESPVKASSNSQKEEKLLQSYSMGMPEVNAVERQALSNTDSPPGCELEPTMKQSFAFDNMGYEESFETLLSPSSQEHTMAVRIVGMTCQSCVQSIEGRISKVEGIVSIKVSLEKNNAVIKYLQSEISPEQICQEIQDMGFDANIAEERLTTETLNASCVREAIVKLRVEGMTCQSCATSIEGKIRKLHGVAKIKVSLGNQEAIIAYYPYIIQPDDLKSHIGNLGYNCTIKSKSAPLKLGVLDLERLQNANPKETAASLKSDGMDPLLAKMSGMATVSVQIEGMHCKSCVRNIEGNISNLPGVQSIKVSLEYKCAVVQYYPNLITLPALQQAIESLPPGNFKVFLHNGSEANKGASPSPALLCDLFREPLQDTASRAVMKIDGMTCNSCVQSIEGTISQRQGVQHIAVSLADRTGTIHYDPAVTNGEELRAAIEDMGFDASVLTDTATGELRHQPDASSAAGQLRPPEPPRPGCVSAGPPDSSPLDEPHQPSGATAEKCFLQITGMTCASCVSTIERNLQKEDGIVSVLVALMAGKAEIKYKPEFIQPLEIAQLIQNLGFEATVIEDHAETEGNVELLITGMTCASCVHNIESKLMRTNGIFYASVALATCKAHIQFDPEITGPRDIIKIIEEIGFHASVARRVPNAHNLDHKKEIQQWRKSFLCSLLFGIPVLILMIYMLIPSGEHHGSMVLEQNLIPGLSILNLLFFVLCTFVQFLGGWYFYVQAYKSLKHKTANMDVLIVMATTIAYVYSCVILMVAIIEKAEESPVTFFDTPPMLFVFIALGRWLEHVAKSKTSEALAKLISLQATEATVVTLGPDHSIIREEQVPVELVQRGDIVKVVPGGKFPVDGKVIEGNSMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVNATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLIAWITIGFMNFDIIKKYFPKQNKHVSKAELILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITCGVPKVMRVLLLGDTAVLSLKKVLAVVGTAEASSEHPLGVAVTKYCKEELGTQSLGYCTDFQAVPGCGISCKVGGVEAFLSTAEEPLDKMDTGRSGGSTAPLGENALITLSESQAPSSPTYSVLIGNREWMRRNGLQIANDINDAMTDHEMKGQTAILVAIDGVLRGMIAVADTVKQEAALAVHTLKNMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNGRSKVAMVGDGVNDSPALARADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLILALIYNLLGIPIAAGVFMPVGLVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDAESYEAQAQGHMKPLSPSQISVHIGMDDRRRDSSRPASWDQISQVSLSSLTSDKLPRCNGFVEEEGDKWSLLMNGGDEEQYI"
     misc_feature    516..701
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(531..539,546..548)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    768..959
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(786..794,801..803)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1107..1280
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1122..1130,1137..1139)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1398..1604
                     /gene="ATP7B"
                     /note="Copper chaperone CopZ [Inorganic ion transport and
                     metabolism]; Region: CopZ; COG2608"
                     /db_xref="CDD:442020"
     misc_feature    1773..1961
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1788..1796,1803..1805)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1998..2189
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(2016..2024,2031..2033)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2253..4391
                     /gene="ATP7B"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(3246..3248,3252..3254,4320..4322)
                     /gene="ATP7B"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(3378..3386,3588..3590,3771..3779,3867..3869,
                     3987..3995,4053..4055,4062..4064,4071..4073,4128..4130,
                     4137..4139)
                     /gene="ATP7B"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      
tggctgatgagcaccttgggtaaatgggcagaactctccgagctgcaagaagagtgtgggggtgataaggcactaagtaactgctctgagaaagctctcctttggtgatatttaaggctggaatgataatggagagaaaactggacaataaaatgaaaagcgaagtgtcctgcttagctactttgaacaacaaaaacataaccctggtgtctattcgtaagcagcaggcagctcatgatgtgcctgaactactgattattggtgaaaagtccaaggcagaatctccggtaaaagcatccagtaactcgcagaaagaagagaaacttttgcagagttactccatgggaatgccagaagtcaatgcagttgaaagacaggctttgtccaacacagattctcctcctggctgtgagctggagcctacaatgaaacaaagttttgcatttgacaacatgggctatgaggagagctttgaaactctgctctctccatcttcccaggaacacaccatggcagtcaggattgtgggaatgacttgccagtcatgtgtgcagtcaatagaaggccgaatttccaaggtggaaggcattgtgagcattaaagtctcccttgaaaagaacaatgctgtaattaagtatctgcagtcagaaataagccctgaacagatttgccaggaaattcaggatatgggctttgatgccaacatagcagaagagaggttgactacagagactctaaatgcatcatgtgtgagagaagcaatagttaaacttcgagtagaaggcatgacttgccagtcctgtgccaccagcattgaaggaaagataagaaaacttcatggtgtggcaaaaatcaaggtgtcacttggtaaccaggaagcaattattgcttactacccttacatcattcagcctgatgacctcaagagccatattggtaacctggggtacaactgcaccattaaaagtaaatcagcccctttgaagttgggtgtcctcgacctcgagcgcttgcagaatgcaaaccccaaggagacagcagcaagtctgaagagtgatgggatggatccactccttgccaagatgagtggcatggctacggtgtctgtacagatagaaggcatgcactgcaagtcctgtgtcagaaacattgaaggaaatatatccaatcttcctggcgtacagagtattaaagtgtctttggagtataaatgtgctgtggtacagtattacccaaatttaattaccctgccagctttacagcaagctattgaatctctgccacctggaaactttaaagtattcctccataatggttcagaagcaaataaaggagcatctccatcccctgctttgctatgtgatctcttcagagagccactgcaagacacagcaagcagagctgttatgaagattgatggtatgacctgcaattcttgtgtacagtccatagaagggaccatatcacagagacaaggagtacaacacatagcagtttctctagctgacagaactgggaccatacattatgatccagctgttactaatggagaagaattaagagctgccatagaagacatggggtttgatgcttctgtgctgacagatacagccacaggagaactcagacaccagcctgatgccagcagtgctgccgggcagcttcgacctccagagcctcctcgcccaggctgtgtttcagctggtcctccagacagttctcccctcgatgagccacaccagcccagtggagctacagctgaaaagtgttttttacaaatcacaggcatgacctgtgcatcgtgtgtgtctaccattgaaagaaatttgcagaaggaagacggaattgtttcagtgttggtagcactgatggcaggtaaagcagagataaaatacaagccagaattcatacagcctcttgaaatagcacagctgatccagaacttgggttttgaagctactgtcatagaagatcatgcagaaacagaaggaaatgtggagcttcttattacagggatgacttgtgcttcttgtgttcacaacattgaatccaaactcatgagaacaaatggcatattctacgcttcagttgcacttgctacttgcaaagctcacatccagtttgatcctgaaattactggacctcgagatattataaagataattgaggaaattggttttcatgcttctgtggcaagaagagttccaaatgcacataacttggatcataaaaaggaaatacagcagtggaggaaatctttcctgtgcagcctactgtttggtatccctgtcttaatcctgatgatttatatgctaatacccagtggggaacaccatggctctatggtgctggaacagaatctcattcctggattatctattttaaatcttctcttctttgtcctgtgcacttttgttcagtttcttggtggatggtatttttatgtccaagcttacaaatccctgaagcacaagacagccaatatggatgtgctcattgtaatggccacaacgattgcttatgtgtattcgtgtgtcatcctgatggtagccataattgaaaaggcagaggaaagccctgtcactttctttgacactcctccaatgctgtttgtgttcattgcccttgggagatggttggaacacgttgcaaagagtaagacctcagaggctcttgctaaacttatatctcttcaagccacagaagccactgtggtgactcttggacctgaccactctatcatcagggaggagcaggtgcctgttgaactggttcagaggggtgatattgtaaaggttgttcctggtggaaaattcccagtggatggaaaagtcatcgaagggaattctatggcagatgagtctctcattactggggaagctatgccagtcactaaaaagcctgggagcacagtaattgctggttctataaatgcacatggctcagttcttgttaatgcaactcatgttggtaatgataccactctggcacaaatcgtgaaattggtggaagaagctcaaatgtcaaaggcacccatccagcaactggcagataagtttagtggatattttgttccatttatcatcatcatttcaacagtgacattgatagcatggatcacgattggttttatgaattttgatattatcaaaaaatattttcctaagcagaacaagcacgtttcaaaagctgagctaatcctgaggtttgcatttcaaacctcaatcactgtgctgagcattgcatgtccctgttccttaggcttggccacccccacagctgtgatggtgggcacaggagttgctgctcagaatgggattctaatcaaaggtggaaaacccctggaaatggcacacaagatcaagactgtgatgtttgataagactgggacgatcacctgtggggttcctaaagtcatgagggtgcttttgctgggagatacagccgtgctctctctgaagaaggtgctggcagtggttggcactgcagaagccagcagcgagcatcctttaggagtagcagtcactaagtactgcaaagaggagcttggcactcagagcctgggatactgcactgacttccaggcagtcccaggctgtggcatcagctgcaaagtcgggggtgttgaggctttcctgagcacagctgaggagcccctggataagatggatactggcaggagtggggggagcactgctcctctgggagagaacgccctgatcacgctctccgaatcacaggctccatcatctcctacgtactcggtgctgattggaaaccgggagtggatgcgacgcaacggtttgcagattgcaaatgacatcaacgatgcaatgacagaccatgagatgaaaggacagactgccatactggtggctatagatggtgtgttgcgtggaatgattgcagtggcagacactgtcaagcaggaggcagcccttgctgtgcacacgctgaaaaacatgggaattgatgtggtgctgataactggggataacagaaaaactgcaaaagccattgctactcaggttgggatcaaaaaagtctttgctgaggtccttccttctcacaaggttgcgaaggtccaggagctccaaaatgggagaagtaaagttgcaatggttggtgatggagtcaatgattcccctgcactggccagggctgatgttggaattgcaattggaacgggcactgatgttgccattgaagcagcagatgtggttctaatccgaaatgacttgctggatgtagttgccagtattcacttatcaaagagaacagttcgaagaatacgaataaatctgattcttgccctaatttataatctgcttggaatacccatagcagcaggtgtgttcatgcctgttggccttgtgcttcagccttggatgggatcagctgcaatggcagcttcttctgtgtctgtggtgctttcttccctgcagctgaaatgttataagaagccagatgcagaaagttatgaagcacaagctcaaggccacatgaagccactttctccttcccaaatcagtgttcatattggaatggatgacaggaggagggactcatccagaccagcttcttgggatcagattagccaggtgtctctctcttccttgacttcagacaagctgccaagatgtaatggttttgttgaggaggaaggggacaaatggtcactgctcatgaatggaggagatgaagaacagtacatctgaagcactgtattcttagtacagcaggaaacattcctccccagaggcggagggggggaatgagttaagacaccaagagattcaggattgctagtgaagtcattccttcacttacacaacaactgcaactcagtttgttgttgggttgtagggactgcggattttttcaactcaccagttatttctagtcatggaaagaatctgtggttctataataaaatggcttcttcatacacaataattaatgaaataatgttaaactgtaattttcgttgtctaaaagagtttctctcctctggattgtttgctgggtacccagtttcatacttttgactcttttttactttattctttcaaaaacacatgaagcaaaggtatttatagagctgtcaaatattcatttctgtgcctaagtgaaaatacccatggcataagcatctcagtggtcacaaattatatttttacataaatgctaaatagccacatcactgtgagagcactttgtatttacgattcatgtgcatctcctggaccaaaaatgcttcagtgtttcactgactataactttctgaaaggtctctttcaaagattttcacttgatttcaggtatgtcttttgatgcacatttccatgactaaacttgtctgttattttcattttctcctatattttctctcttgttccatatgagctttcccccccttttctttgcacagggtatcttctctgatattactctgagatattactatgtttacagatattcctgtctggggcaaactcctttaaattaccagggacttttctgttcttattgaagttcaaagacagcagttcctggtccatatcatttttaatatggatgccttgcaggactccacgaagctcctgacaattctgtagtcatctgtcttttcctctgacagagtgaagaatttctctcagtgtgagtgagtgaggtatttccctggtgtgagtgagagcaggactagcactggtgtgactccagtgtggctgaatggagtgagtttattgcttaagttaaccccagcttgctggttgcttaaaatggagccaaaagtttaaatggtaaaggtgggaaagtggccttaaaatgtgtggtttctgtttgctatcctataaggaaccttttctgatgagagaaggactggaactaatatttgtaatagcttgaatgttaaggtgaatttctattcatgttttgaattggttttgatttccctctttgtttcatgaggaatcaaggtgctgaacaacccttttttcactttaatgtctaccaaagcctgccagtaactctgtcactatgaatgtcaaatttatcccttaaccctttttagccagaacagtaggaatcaaaaactttggtgctctgaatctgcttccttgtgctcccattgctcagccagggacctccaaatcaagcagactgaagttttatgatctaatctaaaaagtgagaagtgaaagagcaagaattaccatgctgaacaacatgaaataactacttattttcactgacttaaatacaggactgtttccaacatgggttcaaattctgcccctcctcatgcaaaaatgaaaactgagtcagagagccaaagaactgtgctaaagcattgagcaagtcttcctattctctcttcctctgaatattatatttgacctttccttagcaaacatcagcagcactaacttaagtataattgtgaatcagttttaaaactgtgaaacctctttgcttgtggagagattactctcacagcacactcacttctcagacatggggaagattgtctactgtctgactgttttatgttttcttaccagtgcatacagtaaaaatattgtgtttttaaaaacaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]