2025-09-19 06:08:41, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS XM_030464403 6602 bp mRNA linear VRT 20-AUG-2019 DEFINITION PREDICTED: Calypte anna ATPase copper transporting beta (ATP7B), transcript variant X1, mRNA. ACCESSION XM_030464403 VERSION XM_030464403.1 DBLINK BioProject: PRJNA558503 KEYWORDS RefSeq. SOURCE Calypte anna (Anna's hummingbird) ORGANISM Calypte anna Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Neoaves; Strisores; Apodiformes; Trochilidae; Calypte. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_044244.1) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Calypte anna Annotation Release 101 Annotation Version :: 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.2 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..6602 /organism="Calypte anna" /mol_type="mRNA" /isolate="BGI_N300" /db_xref="taxon:9244" /chromosome="1" /sex="female" /geo_loc_name="USA" gene 1..6602 /gene="ATP7B" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 4 ESTs, 9 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 2 samples with support for all annotated introns" /db_xref="GeneID:103535568" CDS 123..4718 /gene="ATP7B" /codon_start=1 /product="copper-transporting ATPase 2 isoform X1" /protein_id="XP_030320263.1" /db_xref="GeneID:103535568" /translation="
MIMERKLDNKMKSEVSCLATLNNKNITLVSIRKQQAAHDVPELLIIGEKSKAESPVKASSNSQKEEKLLQSYSMGMPEVNAVERQALSNTDSPPGCELEPTMKQSFAFDNMGYEESFETLLSPSSQEHTMAVRIVGMTCQSCVQSIEGRISKVEGIVSIKVSLEKNNAVIKYLQSEISPEQICQEIQDMGFDANIAEERLTTETLNASCVREAIVKLRVEGMTCQSCATSIEGKIRKLHGVAKIKVSLGNQEAIIAYYPYIIQPDDLKSHIGNLGYNCTIKSKSAPLKLGVLDLERLQNANPKETAASLKSDGMDPLLAKMSGMATVSVQIEGMHCKSCVRNIEGNISNLPGVQSIKVSLEYKCAVVQYYPNLITLPALQQAIESLPPGNFKVFLHNGSEANKGASPSPALLCDLFREPLQDTASRAVMKIDGMTCNSCVQSIEGTISQRQGVQHIAVSLADRTGTIHYDPAVTNGEELRAAIEDMGFDASVLTDTATGELRHQPDASSAAGQLRPPEPPRPGCVSAGPPDSSPLDEPHQPSGATAEKCFLQITGMTCASCVSTIERNLQKEDGIVSVLVALMAGKAEIKYKPEFIQPLEIAQLIQNLGFEATVIEDHAETEGNVELLITGMTCASCVHNIESKLMRTNGIFYASVALATCKAHIQFDPEITGPRDIIKIIEEIGFHASVARRVPNAHNLDHKKEIQQWRKSFLCSLLFGIPVLILMIYMLIPSGEHHGSMVLEQNLIPGLSILNLLFFVLCTFVQFLGGWYFYVQAYKSLKHKTANMDVLIVMATTIAYVYSCVILMVAIIEKAEESPVTFFDTPPMLFVFIALGRWLEHVAKSKTSEALAKLISLQATEATVVTLGPDHSIIREEQVPVELVQRGDIVKVVPGGKFPVDGKVIEGNSMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVNATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLIAWITIGFMNFDIIKKYFPKQNKHVSKAELILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITCGVPKVMRVLLLGDTAVLSLKKVLAVVGTAEASSEHPLGVAVTKYCKEELGTQSLGYCTDFQAVPGCGISCKVGGVEAFLSTAEEPLDKMDTGRSGGSTAPLGENALITLSESQAPSSPTYSVLIGNREWMRRNGLQIANDINDAMTDHEMKGQTAILVAIDGVLRGMIAVADTVKQEAALAVHTLKNMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNGRSKVAMVGDGVNDSPALARADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLILALIYNLLGIPIAAGVFMPVGLVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDAESYEAQAQGHMKPLSPSQISVHIGMDDRRRDSSRPASWDQISQVSLSSLTSDKLPRCNGFVEEEGDKWSLLMNGGDEEQYI"
misc_feature 516..701 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(531..539,546..548) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 768..959 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(786..794,801..803) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1107..1280 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1122..1130,1137..1139) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1398..1604 /gene="ATP7B" /note="Copper chaperone CopZ [Inorganic ion transport and metabolism]; Region: CopZ; COG2608" /db_xref="CDD:442020" misc_feature 1773..1961 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1788..1796,1803..1805) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1998..2189 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(2016..2024,2031..2033) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 2253..4391 /gene="ATP7B" /note="P-type heavy metal-transporting ATPase, similar to human copper-transporting ATPases, ATP7A and ATP7B; Region: P-type_ATPase_Cu-like; cd02094" /db_xref="CDD:319783" misc_feature order(3246..3248,3252..3254,4320..4322) /gene="ATP7B" /note="putative Cu binding site [ion binding]; other site" /db_xref="CDD:319783" misc_feature order(3378..3386,3588..3590,3771..3779,3867..3869, 3987..3995,4053..4055,4062..4064,4071..4073,4128..4130, 4137..4139) /gene="ATP7B" /note="putative ATP binding site [chemical binding]; other site" /db_xref="CDD:319783" ORIGIN
tggctgatgagcaccttgggtaaatgggcagaactctccgagctgcaagaagagtgtgggggtgataaggcactaagtaactgctctgagaaagctctcctttggtgatatttaaggctggaatgataatggagagaaaactggacaataaaatgaaaagcgaagtgtcctgcttagctactttgaacaacaaaaacataaccctggtgtctattcgtaagcagcaggcagctcatgatgtgcctgaactactgattattggtgaaaagtccaaggcagaatctccggtaaaagcatccagtaactcgcagaaagaagagaaacttttgcagagttactccatgggaatgccagaagtcaatgcagttgaaagacaggctttgtccaacacagattctcctcctggctgtgagctggagcctacaatgaaacaaagttttgcatttgacaacatgggctatgaggagagctttgaaactctgctctctccatcttcccaggaacacaccatggcagtcaggattgtgggaatgacttgccagtcatgtgtgcagtcaatagaaggccgaatttccaaggtggaaggcattgtgagcattaaagtctcccttgaaaagaacaatgctgtaattaagtatctgcagtcagaaataagccctgaacagatttgccaggaaattcaggatatgggctttgatgccaacatagcagaagagaggttgactacagagactctaaatgcatcatgtgtgagagaagcaatagttaaacttcgagtagaaggcatgacttgccagtcctgtgccaccagcattgaaggaaagataagaaaacttcatggtgtggcaaaaatcaaggtgtcacttggtaaccaggaagcaattattgcttactacccttacatcattcagcctgatgacctcaagagccatattggtaacctggggtacaactgcaccattaaaagtaaatcagcccctttgaagttgggtgtcctcgacctcgagcgcttgcagaatgcaaaccccaaggagacagcagcaagtctgaagagtgatgggatggatccactccttgccaagatgagtggcatggctacggtgtctgtacagatagaaggcatgcactgcaagtcctgtgtcagaaacattgaaggaaatatatccaatcttcctggcgtacagagtattaaagtgtctttggagtataaatgtgctgtggtacagtattacccaaatttaattaccctgccagctttacagcaagctattgaatctctgccacctggaaactttaaagtattcctccataatggttcagaagcaaataaaggagcatctccatcccctgctttgctatgtgatctcttcagagagccactgcaagacacagcaagcagagctgttatgaagattgatggtatgacctgcaattcttgtgtacagtccatagaagggaccatatcacagagacaaggagtacaacacatagcagtttctctagctgacagaactgggaccatacattatgatccagctgttactaatggagaagaattaagagctgccatagaagacatggggtttgatgcttctgtgctgacagatacagccacaggagaactcagacaccagcctgatgccagcagtgctgccgggcagcttcgacctccagagcctcctcgcccaggctgtgtttcagctggtcctccagacagttctcccctcgatgagccacaccagcccagtggagctacagctgaaaagtgttttttacaaatcacaggcatgacctgtgcatcgtgtgtgtctaccattgaaagaaatttgcagaaggaagacggaattgtttcagtgttggtagcactgatggcaggtaaagcagagataaaatacaagccagaattcatacagcctcttgaaatagcacagctgatccagaacttgggttttgaagctactgtcatagaagatcatgcagaaacagaaggaaatgtggagcttcttattacagggatgacttgtgcttcttgtgttcacaacattgaatccaaactcatgagaacaaatggcatattctacgcttcagttgcacttgctacttgcaaagctcacatccagtttgatcctgaaattactggacctcgagatattataaagataattgaggaaattggttttcatgcttctgtggcaagaagagttccaaatgcacataacttggatcataaaaaggaaatacagcagtggaggaaatctttcctgtgcagcctactgtttggtatccctgtcttaatcctgatgatttatatgctaatacccagtggggaacaccatggctctatggtgctggaacagaatctcattcctggattatctattttaaatcttctcttctttgtcctgtgcacttttgttcagtttcttggtggatggtatttttatgtccaagcttacaaatccctgaagcacaagacagccaatatggatgtgctcattgtaatggccacaacgattgcttatgtgtattcgtgtgtcatcctgatggtagccataattgaaaaggcagaggaaagccctgtcactttctttgacactcctccaatgctgtttgtgttcattgcccttgggagatggttggaacacgttgcaaagagtaagacctcagaggctcttgctaaacttatatctcttcaagccacagaagccactgtggtgactcttggacctgaccactctatcatcagggaggagcaggtgcctgttgaactggttcagaggggtgatattgtaaaggttgttcctggtggaaaattcccagtggatggaaaagtcatcgaagggaattctatggcagatgagtctctcattactggggaagctatgccagtcactaaaaagcctgggagcacagtaattgctggttctataaatgcacatggctcagttcttgttaatgcaactcatgttggtaatgataccactctggcacaaatcgtgaaattggtggaagaagctcaaatgtcaaaggcacccatccagcaactggcagataagtttagtggatattttgttccatttatcatcatcatttcaacagtgacattgatagcatggatcacgattggttttatgaattttgatattatcaaaaaatattttcctaagcagaacaagcacgtttcaaaagctgagctaatcctgaggtttgcatttcaaacctcaatcactgtgctgagcattgcatgtccctgttccttaggcttggccacccccacagctgtgatggtgggcacaggagttgctgctcagaatgggattctaatcaaaggtggaaaacccctggaaatggcacacaagatcaagactgtgatgtttgataagactgggacgatcacctgtggggttcctaaagtcatgagggtgcttttgctgggagatacagccgtgctctctctgaagaaggtgctggcagtggttggcactgcagaagccagcagcgagcatcctttaggagtagcagtcactaagtactgcaaagaggagcttggcactcagagcctgggatactgcactgacttccaggcagtcccaggctgtggcatcagctgcaaagtcgggggtgttgaggctttcctgagcacagctgaggagcccctggataagatggatactggcaggagtggggggagcactgctcctctgggagagaacgccctgatcacgctctccgaatcacaggctccatcatctcctacgtactcggtgctgattggaaaccgggagtggatgcgacgcaacggtttgcagattgcaaatgacatcaacgatgcaatgacagaccatgagatgaaaggacagactgccatactggtggctatagatggtgtgttgcgtggaatgattgcagtggcagacactgtcaagcaggaggcagcccttgctgtgcacacgctgaaaaacatgggaattgatgtggtgctgataactggggataacagaaaaactgcaaaagccattgctactcaggttgggatcaaaaaagtctttgctgaggtccttccttctcacaaggttgcgaaggtccaggagctccaaaatgggagaagtaaagttgcaatggttggtgatggagtcaatgattcccctgcactggccagggctgatgttggaattgcaattggaacgggcactgatgttgccattgaagcagcagatgtggttctaatccgaaatgacttgctggatgtagttgccagtattcacttatcaaagagaacagttcgaagaatacgaataaatctgattcttgccctaatttataatctgcttggaatacccatagcagcaggtgtgttcatgcctgttggccttgtgcttcagccttggatgggatcagctgcaatggcagcttcttctgtgtctgtggtgctttcttccctgcagctgaaatgttataagaagccagatgcagaaagttatgaagcacaagctcaaggccacatgaagccactttctccttcccaaatcagtgttcatattggaatggatgacaggaggagggactcatccagaccagcttcttgggatcagattagccaggtgtctctctcttccttgacttcagacaagctgccaagatgtaatggttttgttgaggaggaaggggacaaatggtcactgctcatgaatggaggagatgaagaacagtacatctgaagcactgtattcttagtacagcaggaaacattcctccccagaggcggagggggggaatgagttaagacaccaagagattcaggattgctagtgaagtcattccttcacttacacaacaactgcaactcagtttgttgttgggttgtagggactgcggattttttcaactcaccagttatttctagtcatggaaagaatctgtggttctataataaaatggcttcttcatacacaataattaatgaaataatgttaaactgtaattttcgttgtctaaaagagtttctctcctctggattgtttgctgggtacccagtttcatacttttgactcttttttactttattctttcaaaaacacatgaagcaaaggtatttatagagctgtcaaatattcatttctgtgcctaagtgaaaatacccatggcataagcatctcagtggtcacaaattatatttttacataaatgctaaatagccacatcactgtgagagcactttgtatttacgattcatgtgcatctcctggaccaaaaatgcttcagtgtttcactgactataactttctgaaaggtctctttcaaagattttcacttgatttcaggtatgtcttttgatgcacatttccatgactaaacttgtctgttattttcattttctcctatattttctctcttgttccatatgagctttcccccccttttctttgcacagggtatcttctctgatattactctgagatattactatgtttacagatattcctgtctggggcaaactcctttaaattaccagggacttttctgttcttattgaagttcaaagacagcagttcctggtccatatcatttttaatatggatgccttgcaggactccacgaagctcctgacaattctgtagtcatctgtcttttcctctgacagagtgaagaatttctctcagtgtgagtgagtgaggtatttccctggtgtgagtgagagcaggactagcactggtgtgactccagtgtggctgaatggagtgagtttattgcttaagttaaccccagcttgctggttgcttaaaatggagccaaaagtttaaatggtaaaggtgggaaagtggccttaaaatgtgtggtttctgtttgctatcctataaggaaccttttctgatgagagaaggactggaactaatatttgtaatagcttgaatgttaaggtgaatttctattcatgttttgaattggttttgatttccctctttgtttcatgaggaatcaaggtgctgaacaacccttttttcactttaatgtctaccaaagcctgccagtaactctgtcactatgaatgtcaaatttatcccttaaccctttttagccagaacagtaggaatcaaaaactttggtgctctgaatctgcttccttgtgctcccattgctcagccagggacctccaaatcaagcagactgaagttttatgatctaatctaaaaagtgagaagtgaaagagcaagaattaccatgctgaacaacatgaaataactacttattttcactgacttaaatacaggactgtttccaacatgggttcaaattctgcccctcctcatgcaaaaatgaaaactgagtcagagagccaaagaactgtgctaaagcattgagcaagtcttcctattctctcttcctctgaatattatatttgacctttccttagcaaacatcagcagcactaacttaagtataattgtgaatcagttttaaaactgtgaaacctctttgcttgtggagagattactctcacagcacactcacttctcagacatggggaagattgtctactgtctgactgttttatgttttcttaccagtgcatacagtaaaaatattgtgtttttaaaaacaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]