GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 05:13:04, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XM_030464273            3416 bp    mRNA    linear   VRT 20-AUG-2019
DEFINITION  PREDICTED: Calypte anna argonaute RISC component 4 (AGO4),
            transcript variant X5, mRNA.
ACCESSION   XM_030464273
VERSION     XM_030464273.1
DBLINK      BioProject: PRJNA558503
KEYWORDS    RefSeq.
SOURCE      Calypte anna (Anna's hummingbird)
  ORGANISM  Calypte anna
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Apodiformes; Trochilidae; Calypte.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_044268.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Calypte anna Annotation Release 101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3416
                     /organism="Calypte anna"
                     /mol_type="mRNA"
                     /isolate="BGI_N300"
                     /db_xref="taxon:9244"
                     /chromosome="23"
                     /sex="female"
                     /country="USA"
     gene            1..3416
                     /gene="AGO4"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 22 ESTs, 43 Proteins, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 1 sample with support for all
                     annotated introns"
                     /db_xref="GeneID:103527616"
     CDS             261..2645
                     /gene="AGO4"
                     /codon_start=1
                     /product="protein argonaute-4 isoform X3"
                     /protein_id="XP_030320133.1"
                     /db_xref="GeneID:103527616"
                     /translation="
MVRHFKMQIFGDRQPGYDGKRNMYTAHPLPIGRDRVDMEVTLPGEGKDQTFKVSIQWVSVVSLQLLLEALAGHLNEVPEDSVQALDVITRHLPSMRYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWNMMLNIDVSATAFYRAQPIIEFMCEVLDIQNINEQTKPLTDSQRVKFTKEIRGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLENGQAMECTVAQYFKQKYSLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVKSNSMVGGPDPYLKEFGIVVHNEMTELTGRVLPAPMLQYGGRNKTVATPNQGVWDMRGKQFYAGIEIKVWAVACFAPQKQCREDLLKSFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFKHLKLTYVGLQLIVVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINAKLGGINNVLVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDGHPSRYCATVRVQTSRQETSQELLYSQEVIQDLTNMVRELLIQFYKSTRFKPTRIIYYRGGVSEGQMKQVAWPELIAIRKACISLEEDYRPGITYIVVQKRHHTRLFCADKTERVGKSGNVPAGTTVDSTITHPSEFDFYLCSHAGIQGTSRPSHYQVLWDDNCFTADELQLLTYQLCHTYVRCTRSVSIPAPAYYARLVAFRARYHLVDKDHDSAEGSHVSGQSNGRDPQALAKAVQIHHDTQHTMYFA"
     misc_feature    270..524
                     /gene="AGO4"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:339747"
     misc_feature    561..707
                     /gene="AGO4"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:337161"
     misc_feature    708..1070
                     /gene="AGO4"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(864..866,909..911,951..953,963..965,1017..1019,
                     1038..1040,1044..1046)
                     /gene="AGO4"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1209..2516
                     /gene="AGO4"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1620..1622,1632..1634,1668..1679,1686..1688,
                     1710..1712,1719..1721,1731..1733,1743..1745)
                     /gene="AGO4"
                     /note="5' RNA guide strand anchoring site; other site"
                     /db_xref="CDD:240015"
     misc_feature    order(1824..1826,1830..1832,2070..2072,2484..2486)
                     /gene="AGO4"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
gcagcctggtgctgtgtcacctgtggaggctgcagacttggtcctgtgcatcaagccacctccttgtgatcgagactgggcccccagcaagcctcttccagccaccccgacgcccaggcctgggaactgttgggaaacccatccgcctcctagccaaccatttccaggttcagatccccaagattgatgtttatcactatgatgtagatatcaaacctgagaaacgcccccgaagagtcaacagggaggtggtggataccatggtgaggcacttcaagatgcagatctttggtgatcggcagcccgggtatgatgggaaacgcaacatgtacactgcccaccccctcccgattggcagggacagagtggatatggaggtgacacttccaggagaagggaaggaccagacatttaaggtgtccattcagtgggtgtcagtcgtcagcctccagctgctgctggaagctctggcagggcacctgaatgaagttcctgaagattctgtgcaggcacttgatgtaatcacacggcaccttccctccatgaggtacactcctgtgggtcgctccttcttctccccccctgaaggttattaccaccctctgggtggtggcagggaggtctggtttggttttcaccagtcagtcaggcctgccatgtggaacatgatgctcaacattgatgtgtcagcaactgctttctatcgtgcccagcctatcattgagttcatgtgtgaggtcttggacattcagaacatcaatgaacaaaccaagcctcttacagactcccagcgtgtcaaatttaccaaagaaatcagaggtctaaaagtagaggttacccattgtggccagatgaagagaaaatacagagtctgcaatgtcactcggaggccagccagtcatcagacgtttcctctgcagctggaaaatgggcaggctatggagtgcacagtagctcagtattttaagcagaagtacagtctgcagctaaaatatcctcaccttccctgtctccaagtaggacaagaacagaaacacacatacttaccccttgaggtgtgcaacatcgtggcaggccagaggtgcatcaagaagctcacagacaatcagacctccaccatgatcaaagcaactgcaaggtctgcaccagacagacaggaggagatcagcagacttgtgaaaagtaacagcatggttggtggacctgatccctatctgaaggagtttggtattgttgtccataatgaaatgactgagttgacaggcagagttttgccagcaccaatgctgcaatatggaggcaggaacaagactgtggccacaccaaaccaaggcgtgtgggacatgagggggaaacagttctatgctggcattgagattaaagtttgggctgttgcctgttttgctcctcaaaaacaatgcagggaagacttactaaagagttttactgaccagctacgcaagatctccaaggatgcagggatgcccatccaaggccagccctgcttctgcaaatatgcccagggggcagacagtgtggagcccatgtttaaacacttaaaactgacttatgttggtctgcagctgatcgtggtgattctccctggaaagactcctgtgtatgctgaagtgaagagggttggtgacactctcctgggcatggccactcagtgtgttcaagtaaagaacgtggtaaaaacctctccacaaacgctgtccaacctgtgtctgaagataaatgcaaagcttggaggaatcaacaacgtccttgtacctcatcaaaggccctcagtgttccagcagccagtgatctttctgggagcagatgtcactcaccctccagctggggatgggaagaagccctccatagcagcagtggtgggcagcatggacgggcaccccagccggtactgtgccaccgtgcgggtccagacctcccgccaggaaacctcccaggagctgctctacagccaggaggtgatccaggacctgaccaacatggtgcgagaactattgatccagttttacaaatccacacgtttcaaacccacgaggatcatttactacagagggggagtgtcagaaggacagatgaagcaggtagcttggccagaactgatagcaatccggaaggcctgtattagtttggaagaagattatagaccaggaataacctacattgttgtgcagaaaaggcatcacaccagactattctgtgctgacaaaactgaaagggtgggcaagagcggcaacgtaccagcaggcactactgtggacagcaccatcacgcatccttctgaatttgacttttacctctgtagccatgcaggaattcagggaaccagccggccctcccactaccaggtgttgtgggatgacaactgtttcactgctgatgagctgcagctgttgacataccagctgtgccacacgtacgtccggtgtacgcggtcggtctctattccagcccctgcctactatgccaggctggtagcctttagggccaggtaccatctcgtggacaaggatcacgacagtgctgaaggcagccacgtgtcagggcagagcaatggccgtgatcctcaggctctggcaaaggcagtgcagatccaccacgacactcagcacacgatgtactttgcttgagagcatctgggaagatgaggccaaaccaacaacccgtgcagtcctgaactggtttgaatgcctactgctctagctagggcccggtttgtttcaggctgcccactaccagcagctctgaacagtcgcactgaatctgtgcttcacagcaatgtctgatgcaccaacacaattgagccatttgtttccttgttttatgtcatagaaatccatagactgtcttttctgatgcattggactgaatttttacctcaaagcgcaaaaggctgatcatcctgaagtttttaaaggacttggcacgaaaggtttctattgaatattttgctagctgtcgtttttaagttctcttctcatcccatgagcttatcatgacgactgattccctctctccaggcactgcttagtgagtatgcatattatggcaaaatgttttactccagttaaatgtaattgttctatcgtgtggggccatagattttttaatggagattttagacttcactactgtaaatgccttttaacagacataactttcacaggtattgcagttttttgtcagttttactaattatctttttaatctctgcagacttcggctgcaaagcaattgcactatactgcgagttcaaataggtggttcttgttctgtgaatgtgtaatataaccagatagtgatgcctgtcagtagattttaattataatggttacaaagaatgctgccatggtatcgtaacaagtactgaaccatcatttccccctctaaaaattataaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]