LOCUS       XM_030309877            4435 bp    mRNA    linear   MAM 09-SEP-2020
DEFINITION  PREDICTED: Lynx canadensis ATPase copper transporting beta (ATP7B),
            transcript variant X4, mRNA.
ACCESSION   XM_030309877
VERSION     XM_030309877.1
DBLINK      BioProject: PRJNA558991
KEYWORDS    RefSeq.
SOURCE      Lynx canadensis (Canada lynx)
  ORGANISM  Lynx canadensis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Carnivora; Feliformia; Felidae;
            Felinae; Lynx.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_044303.2) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Lynx canadensis Annotation Release
                                           102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4435
                     /organism="Lynx canadensis"
                     /mol_type="mRNA"
                     /isolate="LIC74"
                     /db_xref="taxon:61383"
                     /chromosome="A1"
                     /sex="male"
                     /tissue_type="muscle, distal limb"
                     /country="USA: Aroostook County, Maine"
                     /lat_lon="42.2466 N 71.6746 W"
                     /collection_date="2017-12-05"
                     /collected_by="Tanya Lama"
     gene            1..4435
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 4 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 1 sample with support for all annotated introns"
                     /db_xref="GeneID:115510217"
     CDS             119..4435
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X4"
                     /protein_id="XP_030165737.1"
                     /db_xref="GeneID:115510217"
                     /translation="

MQQKQSFAFDNVGYEGGLDSVCPSQTTTGTISISGMTCQSCVKSIEGRISSLKGIVSIKVSLEQGSATVIYVPSVLSLPQVCRHVEDMGFEASITEGKAASWPSRSSSALEATVKLRVEGMTCQSCVSSIEGRLGKLQGVVRARVSLGTQEAVITYQPYLIQPQDLRDHVNDMGFEAVIKNRVAPVSLGPIDIGRLQRTNPKTPLTSGTQNLNNSETLGHQGSRVVTLQLRVDGMHCKSCVLNIEENIGQLPGVQSIQVSLENRIAQVQFDPSRVTPGALQRAIEALPPGNFQVSLPDGAAGSGTDNRPSTHLASAPAPAPAQGTRMQGLGSTVVLAIGGMTCASCVQSIEGLLSRREGVRRVSVSLTEGTGVVLYDPSVINPEGLRAAVEEMGFKASVVSENCYSNHVGNRSTGNSTVHTTAGGPVSVQGMAPHAGGLPKNHNPGSSSKSPQASTAVAPRKCFLQITGMTCASCVSNIERNLQKEAGILSVLVALMAGKAEVKYNPEVIQPLEIAQLIQDLGFEASVMENYTGSDGDLELIITGMTCASCVHNIESKLTRTNGITYASVALATSKAHVKFDPEMIGPRDIVKIIEEIGFHASPAQRNPNVHHLDHKVEIKQWKKSFLCSLMFGIPVMGLMIYMLVPSNEPHETMVLDHNIVPGLSILNLIFFILCTFVQLLGGWYFYIQAYRSLRHGAANMDVLIVLATSIAYTYSVIILVVAVAEKAERSPVTFFDTPPMLFVFIALGRWLEHVAKSKTSEALAKLMSLQATEATVVTLGEDNLIIREEQVPMELVQRGDVIKVVPGGKFPVDGKVLEGSTMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLINATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADRFSGYFVPFIIIISTLTLVVWIIIGFIDFGVVQKYFPTPNKHISQTEVIIRFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITHGVPKVMRVLLLVDVATLPLRKVLAVVGTAEASSEHPLGVAVTKYCKEELGTETLGYCTDFQAVPGCGIGCKVSNVEGILAHGKRQWSTQAGVSNGVGGVPEETDATPQTFSVLIGNREWMRRNGLTISSDISDTMTDHEMKGQTAILVAIDGVLCGMIAIADAVKQEAALAVHTLKSMGVDVVLITGDNRKTARAIATQVGINKVFAEVLPSHKVAKVQELQNEGKRVAMVGDGVNDSPALARADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVWRVRLNLVLALIYNLIGIPIAAGVFMPIGIVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDLERYEAQAQGRMKPLTASQVSVHVGMDDRRRDSPRATPWDQVSYISQVSLSSLKSDRLSRHSAGADDNGDKWSLLLNDRDEEQCI"

     misc_feature    206..397
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(224..232,239..241)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    461..649
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(479..487,494..496)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    803..979
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(821..829,836..838)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1121..1312
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1139..1147,1154..1156)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1511..1699
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1526..1534,1541..1543)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1736..1927
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1754..1762,1769..1771)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1991..4099
                     /gene="ATP7B"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(2984..2986,2990..2992,4028..4030)
                     /gene="ATP7B"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(3116..3124,3326..3328,3479..3487,3575..3577,
                     3695..3703,3761..3763,3770..3772,3779..3781,3836..3838,
                     3845..3847)
                     /gene="ATP7B"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      

gcgccgctcgcccgccctcttgtccttcacacgccgggggccgaagaccgagtccgcagcgtaccggcccgagatcctgtctaaacattctttgcccgctcgtgtctgggagccagcaatgcagcagaagcagagtttcgcctttgacaatgttggctacgagggtggtctggacagcgtgtgcccctctcagacgaccaccggcaccatcagcatttcgggcatgacttgccagtcgtgtgtaaagtctatcgagggcaggatttcgagtttgaaaggcatcgtgagcattaaggtttccctggaacaaggcagcgcgactgtgatctatgtgccgtcggtcctgagcctgccgcaggtttgccgtcacgtcgaggacatgggcttcgaggccagcatcacagaaggaaaggccgcctcctggccctcgagatcctcgtctgccctggaggccacggtcaagctccgggtggagggcatgacctgccagtcctgtgtcagctccatcgaaggcaggctggggaagctgcaaggggtagtgagggcccgagtctcccttggcacccaggaggcagtcattacttaccagccttatctcattcagccccaagacctcagggaccacgtaaatgacatgggatttgaagctgtcatcaagaacagagtggcacctgtaagcctgggaccaattgatattgggcggttacagaggaccaacccaaagacccctttgacgtctggtacccagaatctcaataactctgagaccttggggcaccaagggagccgtgtggtcaccctgcaactgagagtagatggaatgcactgtaaatcttgtgtcctgaatattgaagaaaatataggccaactcccaggggttcaaagtattcaagtgtccttggagaacagaattgcccaagtacagtttgacccttctcgtgtcacccccggggccctgcagagggccattgaggctcttcctcctgggaactttcaagtttctcttcctgatggagcagcggggagtggcaccgataacaggccttccacgcatctcgcctccgcccccgcccccgcccctgcccagggaacccggatgcaaggcctgggcagtaccgtggtgcttgccattggtggcatgacctgtgcgtcctgcgtccagtccatcgaaggcctgctctcccgcagggaaggggtgcgacgagtatcagtctctctgactgaagggactggagtggtgctctatgatccctctgtaattaacccggaaggactccgagctgctgttgaagaaatgggattcaaggcgtcagtcgtttctgaaaactgttacagcaaccatgttggaaaccgcagcacaggtaattccacagtgcacaccacagctggcggacctgtgtctgtgcagggaatggctccccatgctggggggctccctaagaaccacaaccccggcagctcgtcaaagtccccgcaggcctctacagcagtggcaccacggaagtgctttttacagatcacaggcatgacctgtgcatcctgtgtgtctaacatagagagaaaccttcagaaagaggcaggtattctctcggtgctggtcgccttgatggctggaaaggcagaggttaagtacaatccggaagtcatccagccgctggagatagctcagctcatccaggacttgggctttgaggcttcggtaatggaaaactacacaggctcagatggtgacctcgagctgatcatcacgggcatgacctgtgcatcctgtgttcacaacatagagtccaaactcaccagaacgaacggcatcacctacgcctctgtggcccttgccaccagcaaagcccacgtgaaatttgatcctgaaatgattggtccgcgggatattgtcaagattatcgaggaaatcggctttcatgcctccccggcccagagaaaccccaacgtgcatcacttggaccacaaggtggagataaagcagtggaagaagtcttttctgtgcagcctgatgtttggcatccctgttatgggtttaatgatctatatgttggtgcccagcaacgagccccacgagacaatggtcctggaccacaacatcgttccaggactgtccattctaaatctcatcttctttatcctgtgcaccttcgtccagctccttggcgggtggtacttctacatccaggcctacagatctctgcggcacggggcggccaacatggacgtgctcatcgtgctggccacgagcatcgcctatacctactcagtcatcatcctggtggtggccgtggctgagaaggcggagagaagccccgtgaccttctttgacaccccccccatgctctttgtgttcattgccctgggccggtggctggaacacgtggcgaagagcaaaacctcagaagcccttgccaaactcatgtctctccaagccacggaagccaccgttgtgacccttggcgaggacaacttgatcatcagagaggagcaagtacccatggagctggtgcagcggggcgacgtcatcaaggtcgtccccggcggaaagttcccggtggacgggaaagtcctggaaggcagtaccatggctgacgagtccctcatcacaggagaagccatgcctgtcactaagaaacccggaagcacagtgattgctgggtctataaacgcacatggctctgtgctcattaacgccacccacgtgggcaatgacaccactttggctcagattgtgaaattagtagaagaggctcagatgtcaaaggcacccattcagcaactggctgaccggtttagtggatattttgtcccatttatcatcatcatttcaacgttgacgttggtggtatggattataatcggttttatcgattttggtgttgttcagaaatactttcctacccccaacaagcacatctcccagacagaggtgatcatccggtttgcgttccagacatccatcacggtgctctgcattgcgtgcccctgctcgctgggcttggccacacccacggcggtcatggtgggcaccggggtggccgcccagaatggcatcctcatcaagggaggcaagcctctggaaatggcccacaagataaagactgtgatgtttgacaaaactggcaccattacccacggggtccccaaggtcatgagggtcctcctgctcgtggatgtggccacgctgcccctcaggaaggttcttgctgtggtggggactgcggaggccagcagcgagcaccccctgggtgtggcagtcaccaagtactgtaaagaggagctgggaacagagaccctggggtactgcacagacttccaggcggtgccaggctgcggaattggctgtaaagtcagcaacgtggagggcatcctggcccacggcaagcgccagtggagcacacaggctggggtctcgaacggcgttggcggtgtccctgaggagacagatgcaaccccccagaccttctctgtgctgattgggaaccgcgaatggatgaggcgcaacggcttaaccatttccagcgacatcagtgacactatgacagatcacgagatgaaaggccagacagccatcctggtggccattgatggcgtgctctgcgggatgattgccatcgcggatgctgtcaagcaggaggcagccctggccgtgcacacgctgaagagcatgggcgtggatgtggttctgatcactggggacaaccggaagacggccagagccattgccacccaggttggcatcaacaaagtctttgcagaggtgctgccttctcacaaggtggccaaggtccaggagctccagaatgaagggaagagagtcgccatggtgggagatggggtcaacgactcgccggccttggcccgggccgacgtgggcattgccatcgggacaggcacagatgtcgccattgaggctgctgatgttgtcctcatcagaaacgacttgctcgacgtggtggcgagcattcacctctccaagaggaccgtctggagagtacgactcaatctggtgctggcattgatttataatctgatcgggatacccatcgcggcaggggtcttcatgcccatcggcatcgtgctacagccgtggatgggctcagcggccatggcggcctcctccgtgtctgtggttctctcgtcgctgcaactcaagtgctataagaagcccgacctggagaggtatgaggcccaggcccagggccgcatgaagcccctgactgcgtcccaggtcagcgtgcacgttggcatggatgaccggcgacgggactcaccgagggccacgccctgggaccaggtcagctacatcagccaggtgtctctgtcctcactgaagtcggacaggctgtctcggcacagtgctggggctgacgacaatggggacaaatggtctctgctcctgaatgacagagatgaggagcagtgcatctga

//