2024-03-29 08:11:55, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_030309842 5781 bp mRNA linear MAM 09-SEP-2020 DEFINITION PREDICTED: Lynx canadensis ATPase copper transporting beta (ATP7B), transcript variant X1, mRNA. ACCESSION XM_030309842 VERSION XM_030309842.1 DBLINK BioProject: PRJNA558991 KEYWORDS RefSeq. SOURCE Lynx canadensis (Canada lynx) ORGANISM Lynx canadensis Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Carnivora; Feliformia; Felidae; Felinae; Lynx. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_044303.2) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Lynx canadensis Annotation Release 102 Annotation Version :: 102 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.5 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..5781 /organism="Lynx canadensis" /mol_type="mRNA" /isolate="LIC74" /db_xref="taxon:61383" /chromosome="A1" /sex="male" /tissue_type="muscle, distal limb" /country="USA: Aroostook County, Maine" /lat_lon="42.2466 N 71.6746 W" /collection_date="2017-12-05" /collected_by="Tanya Lama" gene 1..5781 /gene="ATP7B" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 4 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments" /db_xref="GeneID:115510217" CDS 150..4808 /gene="ATP7B" /codon_start=1 /product="copper-transporting ATPase 2 isoform X1" /protein_id="XP_030165702.1" /db_xref="GeneID:115510217" /translation="
MVGKGVTVDTAMEKAGGDTPGSPEPSFLATLGDPQVTLVSVHKRWSFRRNPGTGGSTRPVTSEEEGEFSQKVLNGTRGIRSNQILSKHSLPARVWEPAMQQKQSFAFDNVGYEGGLDSVCPSQTTTGTISISGMTCQSCVKSIEGRISSLKGIVSIKVSLEQGSATVIYVPSVLSLPQVCRHVEDMGFEASITEGKAASWPSRSSSALEATVKLRVEGMTCQSCVSSIEGRLGKLQGVVRARVSLGTQEAVITYQPYLIQPQDLRDHVNDMGFEAVIKNRVAPVSLGPIDIGRLQRTNPKTPLTSGTQNLNNSETLGHQGSRVVTLQLRVDGMHCKSCVLNIEENIGQLPGVQSIQVSLENRIAQVQFDPSRVTPGALQRAIEALPPGNFQVSLPDGAAGSGTDNRPSTHLASAPAPAPAQGTRMQGLGSTVVLAIGGMTCASCVQSIEGLLSRREGVRRVSVSLTEGTGVVLYDPSVINPEGLRAAVEEMGFKASVVSENCYSNHVGNRSTGNSTVHTTAGGPVSVQGMAPHAGGLPKNHNPGSSSKSPQASTAVAPRKCFLQITGMTCASCVSNIERNLQKEAGILSVLVALMAGKAEVKYNPEVIQPLEIAQLIQDLGFEASVMENYTGSDGDLELIITGMTCASCVHNIESKLTRTNGITYASVALATSKAHVKFDPEMIGPRDIVKIIEEIGFHASPAQRNPNVHHLDHKVEIKQWKKSFLCSLMFGIPVMGLMIYMLVPSNEPHETMVLDHNIVPGLSILNLIFFILCTFVQLLGGWYFYIQAYRSLRHGAANMDVLIVLATSIAYTYSVIILVVAVAEKAERSPVTFFDTPPMLFVFIALGRWLEHVAKSKTSEALAKLMSLQATEATVVTLGEDNLIIREEQVPMELVQRGDVIKVVPGGKFPVDGKVLEGSTMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLINATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADRFSGYFVPFIIIISTLTLVVWIIIGFIDFGVVQKYFPTPNKHISQTEVIIRFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITHGVPKVMRVLLLVDVATLPLRKVLAVVGTAEASSEHPLGVAVTKYCKEELGTETLGYCTDFQAVPGCGIGCKVSNVEGILAHGKRQWSTQAGVSNGVGGVPEETDATPQTFSVLIGNREWMRRNGLTISSDISDTMTDHEMKGQTAILVAIDGVLCGMIAIADAVKQEAALAVHTLKSMGVDVVLITGDNRKTARAIATQVGINKVFAEVLPSHKVAKVQELQNEGKRVAMVGDGVNDSPALARADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVWRVRLNLVLALIYNLIGIPIAAGVFMPIGIVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDLERYEAQAQGRMKPLTASQVSVHVGMDDRRRDSPRATPWDQASGSFRLHGLLRDRHLVAFIQNSCQACPWWCATPSKQRYPNQRKSVILHELLLLHPESVP"
misc_feature 531..722 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(549..557,564..566) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 786..974 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(804..812,819..821) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1128..1304 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1146..1154,1161..1163) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1446..1637 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1464..1472,1479..1481) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1836..2024 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1851..1859,1866..1868) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 2061..2252 /gene="ATP7B" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(2079..2087,2094..2096) /gene="ATP7B" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 2316..4424 /gene="ATP7B" /note="P-type heavy metal-transporting ATPase, similar to human copper-transporting ATPases, ATP7A and ATP7B; Region: P-type_ATPase_Cu-like; cd02094" /db_xref="CDD:319783" misc_feature order(3309..3311,3315..3317,4353..4355) /gene="ATP7B" /note="putative Cu binding site [ion binding]; other site" /db_xref="CDD:319783" misc_feature order(3441..3449,3651..3653,3804..3812,3900..3902, 4020..4028,4086..4088,4095..4097,4104..4106,4161..4163, 4170..4172) /gene="ATP7B" /note="putative ATP binding site [chemical binding]; other site" /db_xref="CDD:319783" ORIGIN
cagcctctcccccactggctccagagcagaggggaatctgcaggactgacggatcacaggtgcctccccctgctagttaggaggacacttttaaagcatttccttctcactcgaccaggtagtctggtgagggtgaacagcttgcttgaatggtgggtaaaggtgtgaccgtggacacagcgatggagaaagccgggggtgacacgcccgggagccctgagccgtccttcctggcgactctgggtgacccacaggtgaccctcgtgtccgtccacaagcggtggtccttcaggaggaatcctgggaccgggggctccaccaggccagtgacttcggaggaggaaggagagttttcacagaaggttttgaatggaacacggggaatccgttccaatcagatcctgtctaaacattctttgcccgctcgtgtctgggagccagcaatgcagcagaagcagagtttcgcctttgacaatgttggctacgagggtggtctggacagcgtgtgcccctctcagacgaccaccggcaccatcagcatttcgggcatgacttgccagtcgtgtgtaaagtctatcgagggcaggatttcgagtttgaaaggcatcgtgagcattaaggtttccctggaacaaggcagcgcgactgtgatctatgtgccgtcggtcctgagcctgccgcaggtttgccgtcacgtcgaggacatgggcttcgaggccagcatcacagaaggaaaggccgcctcctggccctcgagatcctcgtctgccctggaggccacggtcaagctccgggtggagggcatgacctgccagtcctgtgtcagctccatcgaaggcaggctggggaagctgcaaggggtagtgagggcccgagtctcccttggcacccaggaggcagtcattacttaccagccttatctcattcagccccaagacctcagggaccacgtaaatgacatgggatttgaagctgtcatcaagaacagagtggcacctgtaagcctgggaccaattgatattgggcggttacagaggaccaacccaaagacccctttgacgtctggtacccagaatctcaataactctgagaccttggggcaccaagggagccgtgtggtcaccctgcaactgagagtagatggaatgcactgtaaatcttgtgtcctgaatattgaagaaaatataggccaactcccaggggttcaaagtattcaagtgtccttggagaacagaattgcccaagtacagtttgacccttctcgtgtcacccccggggccctgcagagggccattgaggctcttcctcctgggaactttcaagtttctcttcctgatggagcagcggggagtggcaccgataacaggccttccacgcatctcgcctccgcccccgcccccgcccctgcccagggaacccggatgcaaggcctgggcagtaccgtggtgcttgccattggtggcatgacctgtgcgtcctgcgtccagtccatcgaaggcctgctctcccgcagggaaggggtgcgacgagtatcagtctctctgactgaagggactggagtggtgctctatgatccctctgtaattaacccggaaggactccgagctgctgttgaagaaatgggattcaaggcgtcagtcgtttctgaaaactgttacagcaaccatgttggaaaccgcagcacaggtaattccacagtgcacaccacagctggcggacctgtgtctgtgcagggaatggctccccatgctggggggctccctaagaaccacaaccccggcagctcgtcaaagtccccgcaggcctctacagcagtggcaccacggaagtgctttttacagatcacaggcatgacctgtgcatcctgtgtgtctaacatagagagaaaccttcagaaagaggcaggtattctctcggtgctggtcgccttgatggctggaaaggcagaggttaagtacaatccggaagtcatccagccgctggagatagctcagctcatccaggacttgggctttgaggcttcggtaatggaaaactacacaggctcagatggtgacctcgagctgatcatcacgggcatgacctgtgcatcctgtgttcacaacatagagtccaaactcaccagaacgaacggcatcacctacgcctctgtggcccttgccaccagcaaagcccacgtgaaatttgatcctgaaatgattggtccgcgggatattgtcaagattatcgaggaaatcggctttcatgcctccccggcccagagaaaccccaacgtgcatcacttggaccacaaggtggagataaagcagtggaagaagtcttttctgtgcagcctgatgtttggcatccctgttatgggtttaatgatctatatgttggtgcccagcaacgagccccacgagacaatggtcctggaccacaacatcgttccaggactgtccattctaaatctcatcttctttatcctgtgcaccttcgtccagctccttggcgggtggtacttctacatccaggcctacagatctctgcggcacggggcggccaacatggacgtgctcatcgtgctggccacgagcatcgcctatacctactcagtcatcatcctggtggtggccgtggctgagaaggcggagagaagccccgtgaccttctttgacaccccccccatgctctttgtgttcattgccctgggccggtggctggaacacgtggcgaagagcaaaacctcagaagcccttgccaaactcatgtctctccaagccacggaagccaccgttgtgacccttggcgaggacaacttgatcatcagagaggagcaagtacccatggagctggtgcagcggggcgacgtcatcaaggtcgtccccggcggaaagttcccggtggacgggaaagtcctggaaggcagtaccatggctgacgagtccctcatcacaggagaagccatgcctgtcactaagaaacccggaagcacagtgattgctgggtctataaacgcacatggctctgtgctcattaacgccacccacgtgggcaatgacaccactttggctcagattgtgaaattagtagaagaggctcagatgtcaaaggcacccattcagcaactggctgaccggtttagtggatattttgtcccatttatcatcatcatttcaacgttgacgttggtggtatggattataatcggttttatcgattttggtgttgttcagaaatactttcctacccccaacaagcacatctcccagacagaggtgatcatccggtttgcgttccagacatccatcacggtgctctgcattgcgtgcccctgctcgctgggcttggccacacccacggcggtcatggtgggcaccggggtggccgcccagaatggcatcctcatcaagggaggcaagcctctggaaatggcccacaagataaagactgtgatgtttgacaaaactggcaccattacccacggggtccccaaggtcatgagggtcctcctgctcgtggatgtggccacgctgcccctcaggaaggttcttgctgtggtggggactgcggaggccagcagcgagcaccccctgggtgtggcagtcaccaagtactgtaaagaggagctgggaacagagaccctggggtactgcacagacttccaggcggtgccaggctgcggaattggctgtaaagtcagcaacgtggagggcatcctggcccacggcaagcgccagtggagcacacaggctggggtctcgaacggcgttggcggtgtccctgaggagacagatgcaaccccccagaccttctctgtgctgattgggaaccgcgaatggatgaggcgcaacggcttaaccatttccagcgacatcagtgacactatgacagatcacgagatgaaaggccagacagccatcctggtggccattgatggcgtgctctgcgggatgattgccatcgcggatgctgtcaagcaggaggcagccctggccgtgcacacgctgaagagcatgggcgtggatgtggttctgatcactggggacaaccggaagacggccagagccattgccacccaggttggcatcaacaaagtctttgcagaggtgctgccttctcacaaggtggccaaggtccaggagctccagaatgaagggaagagagtcgccatggtgggagatggggtcaacgactcgccggccttggcccgggccgacgtgggcattgccatcgggacaggcacagatgtcgccattgaggctgctgatgttgtcctcatcagaaacgacttgctcgacgtggtggcgagcattcacctctccaagaggaccgtctggagagtacgactcaatctggtgctggcattgatttataatctgatcgggatacccatcgcggcaggggtcttcatgcccatcggcatcgtgctacagccgtggatgggctcagcggccatggcggcctcctccgtgtctgtggttctctcgtcgctgcaactcaagtgctataagaagcccgacctggagaggtatgaggcccaggcccagggccgcatgaagcccctgactgcgtcccaggtcagcgtgcacgttggcatggatgaccggcgacgggactcaccgagggccacgccctgggaccaggcctccgggagcttcagattacatggtctgctgcgtgaccgtcacctcgtggcattcattcagaactcctgccaggcgtgcccctggtggtgtgcaactccaagcaaacaacgatacccaaatcagaggaaatcagttattctccatgagctcctacttctgcaccctgagtcagtgccttaggaaaggagtcaccacaccttccccaagggaaagtctttcacactttgagtggctctttgtggtggggcaggaatggggccagttttagactctaaagtcggtggtagttgacagaactacatgggagttagacgagtagggtgaaataaattttaaggtagagccctgatcgcatacacagaataattttatttattgagtatcagttatttttcagggacaatataagcactttctataggttacctctaatcctcccagcataccagcaaagtagatacgattgtccgcattttataggcggggcagtaggcccagagaggctacgtatcctgtccaggatcacacagccagcacgcttgccaaaacggggatccaaagccatgtctcttggcgctgaagtcttttctttattgccgctgccacccgaatatcagtttggtaagaataaataggaaaagggcacttggctctcagaagaacaaagctgccaggcagtacactcattgttatcaactgggcatgaaatttgaccgtggggtcaacttcctcaccttctccttggatggtctgtttccattttcgcatatgattccattctgttgggtcttgccctctaagatgcaagtgcagggttctgtagtgcctctatcattttcagtcttcctctccttccaggccccttcccgttcttcccttcctttattcctggctgtgcttgggagtgtttcttgttttcttaactaggttaatcattgtctaaagaatctaactgcattgatttttttcaaaggcttttaggaccataaacatcatgtgtatatggccatgaaaatatttatataattgcacagaatgtaacctttagatgttcaaggggtaaggatttttgtgtgcgtcagataagagcagtccctattccaaaaactttccatgctgtattagaataaagtttatttttattcatctgaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]