GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-03-29 08:11:55, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_030309842            5781 bp    mRNA    linear   MAM 09-SEP-2020
DEFINITION  PREDICTED: Lynx canadensis ATPase copper transporting beta (ATP7B),
            transcript variant X1, mRNA.
ACCESSION   XM_030309842
VERSION     XM_030309842.1
DBLINK      BioProject: PRJNA558991
KEYWORDS    RefSeq.
SOURCE      Lynx canadensis (Canada lynx)
  ORGANISM  Lynx canadensis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Carnivora; Feliformia; Felidae;
            Felinae; Lynx.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_044303.2) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Lynx canadensis Annotation Release
                                           102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..5781
                     /organism="Lynx canadensis"
                     /mol_type="mRNA"
                     /isolate="LIC74"
                     /db_xref="taxon:61383"
                     /chromosome="A1"
                     /sex="male"
                     /tissue_type="muscle, distal limb"
                     /country="USA: Aroostook County, Maine"
                     /lat_lon="42.2466 N 71.6746 W"
                     /collection_date="2017-12-05"
                     /collected_by="Tanya Lama"
     gene            1..5781
                     /gene="ATP7B"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 4 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments"
                     /db_xref="GeneID:115510217"
     CDS             150..4808
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X1"
                     /protein_id="XP_030165702.1"
                     /db_xref="GeneID:115510217"
                     /translation="
MVGKGVTVDTAMEKAGGDTPGSPEPSFLATLGDPQVTLVSVHKRWSFRRNPGTGGSTRPVTSEEEGEFSQKVLNGTRGIRSNQILSKHSLPARVWEPAMQQKQSFAFDNVGYEGGLDSVCPSQTTTGTISISGMTCQSCVKSIEGRISSLKGIVSIKVSLEQGSATVIYVPSVLSLPQVCRHVEDMGFEASITEGKAASWPSRSSSALEATVKLRVEGMTCQSCVSSIEGRLGKLQGVVRARVSLGTQEAVITYQPYLIQPQDLRDHVNDMGFEAVIKNRVAPVSLGPIDIGRLQRTNPKTPLTSGTQNLNNSETLGHQGSRVVTLQLRVDGMHCKSCVLNIEENIGQLPGVQSIQVSLENRIAQVQFDPSRVTPGALQRAIEALPPGNFQVSLPDGAAGSGTDNRPSTHLASAPAPAPAQGTRMQGLGSTVVLAIGGMTCASCVQSIEGLLSRREGVRRVSVSLTEGTGVVLYDPSVINPEGLRAAVEEMGFKASVVSENCYSNHVGNRSTGNSTVHTTAGGPVSVQGMAPHAGGLPKNHNPGSSSKSPQASTAVAPRKCFLQITGMTCASCVSNIERNLQKEAGILSVLVALMAGKAEVKYNPEVIQPLEIAQLIQDLGFEASVMENYTGSDGDLELIITGMTCASCVHNIESKLTRTNGITYASVALATSKAHVKFDPEMIGPRDIVKIIEEIGFHASPAQRNPNVHHLDHKVEIKQWKKSFLCSLMFGIPVMGLMIYMLVPSNEPHETMVLDHNIVPGLSILNLIFFILCTFVQLLGGWYFYIQAYRSLRHGAANMDVLIVLATSIAYTYSVIILVVAVAEKAERSPVTFFDTPPMLFVFIALGRWLEHVAKSKTSEALAKLMSLQATEATVVTLGEDNLIIREEQVPMELVQRGDVIKVVPGGKFPVDGKVLEGSTMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLINATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADRFSGYFVPFIIIISTLTLVVWIIIGFIDFGVVQKYFPTPNKHISQTEVIIRFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITHGVPKVMRVLLLVDVATLPLRKVLAVVGTAEASSEHPLGVAVTKYCKEELGTETLGYCTDFQAVPGCGIGCKVSNVEGILAHGKRQWSTQAGVSNGVGGVPEETDATPQTFSVLIGNREWMRRNGLTISSDISDTMTDHEMKGQTAILVAIDGVLCGMIAIADAVKQEAALAVHTLKSMGVDVVLITGDNRKTARAIATQVGINKVFAEVLPSHKVAKVQELQNEGKRVAMVGDGVNDSPALARADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVWRVRLNLVLALIYNLIGIPIAAGVFMPIGIVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDLERYEAQAQGRMKPLTASQVSVHVGMDDRRRDSPRATPWDQASGSFRLHGLLRDRHLVAFIQNSCQACPWWCATPSKQRYPNQRKSVILHELLLLHPESVP"
     misc_feature    531..722
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(549..557,564..566)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    786..974
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(804..812,819..821)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1128..1304
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1146..1154,1161..1163)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1446..1637
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1464..1472,1479..1481)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1836..2024
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1851..1859,1866..1868)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2061..2252
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(2079..2087,2094..2096)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2316..4424
                     /gene="ATP7B"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(3309..3311,3315..3317,4353..4355)
                     /gene="ATP7B"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(3441..3449,3651..3653,3804..3812,3900..3902,
                     4020..4028,4086..4088,4095..4097,4104..4106,4161..4163,
                     4170..4172)
                     /gene="ATP7B"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      
cagcctctcccccactggctccagagcagaggggaatctgcaggactgacggatcacaggtgcctccccctgctagttaggaggacacttttaaagcatttccttctcactcgaccaggtagtctggtgagggtgaacagcttgcttgaatggtgggtaaaggtgtgaccgtggacacagcgatggagaaagccgggggtgacacgcccgggagccctgagccgtccttcctggcgactctgggtgacccacaggtgaccctcgtgtccgtccacaagcggtggtccttcaggaggaatcctgggaccgggggctccaccaggccagtgacttcggaggaggaaggagagttttcacagaaggttttgaatggaacacggggaatccgttccaatcagatcctgtctaaacattctttgcccgctcgtgtctgggagccagcaatgcagcagaagcagagtttcgcctttgacaatgttggctacgagggtggtctggacagcgtgtgcccctctcagacgaccaccggcaccatcagcatttcgggcatgacttgccagtcgtgtgtaaagtctatcgagggcaggatttcgagtttgaaaggcatcgtgagcattaaggtttccctggaacaaggcagcgcgactgtgatctatgtgccgtcggtcctgagcctgccgcaggtttgccgtcacgtcgaggacatgggcttcgaggccagcatcacagaaggaaaggccgcctcctggccctcgagatcctcgtctgccctggaggccacggtcaagctccgggtggagggcatgacctgccagtcctgtgtcagctccatcgaaggcaggctggggaagctgcaaggggtagtgagggcccgagtctcccttggcacccaggaggcagtcattacttaccagccttatctcattcagccccaagacctcagggaccacgtaaatgacatgggatttgaagctgtcatcaagaacagagtggcacctgtaagcctgggaccaattgatattgggcggttacagaggaccaacccaaagacccctttgacgtctggtacccagaatctcaataactctgagaccttggggcaccaagggagccgtgtggtcaccctgcaactgagagtagatggaatgcactgtaaatcttgtgtcctgaatattgaagaaaatataggccaactcccaggggttcaaagtattcaagtgtccttggagaacagaattgcccaagtacagtttgacccttctcgtgtcacccccggggccctgcagagggccattgaggctcttcctcctgggaactttcaagtttctcttcctgatggagcagcggggagtggcaccgataacaggccttccacgcatctcgcctccgcccccgcccccgcccctgcccagggaacccggatgcaaggcctgggcagtaccgtggtgcttgccattggtggcatgacctgtgcgtcctgcgtccagtccatcgaaggcctgctctcccgcagggaaggggtgcgacgagtatcagtctctctgactgaagggactggagtggtgctctatgatccctctgtaattaacccggaaggactccgagctgctgttgaagaaatgggattcaaggcgtcagtcgtttctgaaaactgttacagcaaccatgttggaaaccgcagcacaggtaattccacagtgcacaccacagctggcggacctgtgtctgtgcagggaatggctccccatgctggggggctccctaagaaccacaaccccggcagctcgtcaaagtccccgcaggcctctacagcagtggcaccacggaagtgctttttacagatcacaggcatgacctgtgcatcctgtgtgtctaacatagagagaaaccttcagaaagaggcaggtattctctcggtgctggtcgccttgatggctggaaaggcagaggttaagtacaatccggaagtcatccagccgctggagatagctcagctcatccaggacttgggctttgaggcttcggtaatggaaaactacacaggctcagatggtgacctcgagctgatcatcacgggcatgacctgtgcatcctgtgttcacaacatagagtccaaactcaccagaacgaacggcatcacctacgcctctgtggcccttgccaccagcaaagcccacgtgaaatttgatcctgaaatgattggtccgcgggatattgtcaagattatcgaggaaatcggctttcatgcctccccggcccagagaaaccccaacgtgcatcacttggaccacaaggtggagataaagcagtggaagaagtcttttctgtgcagcctgatgtttggcatccctgttatgggtttaatgatctatatgttggtgcccagcaacgagccccacgagacaatggtcctggaccacaacatcgttccaggactgtccattctaaatctcatcttctttatcctgtgcaccttcgtccagctccttggcgggtggtacttctacatccaggcctacagatctctgcggcacggggcggccaacatggacgtgctcatcgtgctggccacgagcatcgcctatacctactcagtcatcatcctggtggtggccgtggctgagaaggcggagagaagccccgtgaccttctttgacaccccccccatgctctttgtgttcattgccctgggccggtggctggaacacgtggcgaagagcaaaacctcagaagcccttgccaaactcatgtctctccaagccacggaagccaccgttgtgacccttggcgaggacaacttgatcatcagagaggagcaagtacccatggagctggtgcagcggggcgacgtcatcaaggtcgtccccggcggaaagttcccggtggacgggaaagtcctggaaggcagtaccatggctgacgagtccctcatcacaggagaagccatgcctgtcactaagaaacccggaagcacagtgattgctgggtctataaacgcacatggctctgtgctcattaacgccacccacgtgggcaatgacaccactttggctcagattgtgaaattagtagaagaggctcagatgtcaaaggcacccattcagcaactggctgaccggtttagtggatattttgtcccatttatcatcatcatttcaacgttgacgttggtggtatggattataatcggttttatcgattttggtgttgttcagaaatactttcctacccccaacaagcacatctcccagacagaggtgatcatccggtttgcgttccagacatccatcacggtgctctgcattgcgtgcccctgctcgctgggcttggccacacccacggcggtcatggtgggcaccggggtggccgcccagaatggcatcctcatcaagggaggcaagcctctggaaatggcccacaagataaagactgtgatgtttgacaaaactggcaccattacccacggggtccccaaggtcatgagggtcctcctgctcgtggatgtggccacgctgcccctcaggaaggttcttgctgtggtggggactgcggaggccagcagcgagcaccccctgggtgtggcagtcaccaagtactgtaaagaggagctgggaacagagaccctggggtactgcacagacttccaggcggtgccaggctgcggaattggctgtaaagtcagcaacgtggagggcatcctggcccacggcaagcgccagtggagcacacaggctggggtctcgaacggcgttggcggtgtccctgaggagacagatgcaaccccccagaccttctctgtgctgattgggaaccgcgaatggatgaggcgcaacggcttaaccatttccagcgacatcagtgacactatgacagatcacgagatgaaaggccagacagccatcctggtggccattgatggcgtgctctgcgggatgattgccatcgcggatgctgtcaagcaggaggcagccctggccgtgcacacgctgaagagcatgggcgtggatgtggttctgatcactggggacaaccggaagacggccagagccattgccacccaggttggcatcaacaaagtctttgcagaggtgctgccttctcacaaggtggccaaggtccaggagctccagaatgaagggaagagagtcgccatggtgggagatggggtcaacgactcgccggccttggcccgggccgacgtgggcattgccatcgggacaggcacagatgtcgccattgaggctgctgatgttgtcctcatcagaaacgacttgctcgacgtggtggcgagcattcacctctccaagaggaccgtctggagagtacgactcaatctggtgctggcattgatttataatctgatcgggatacccatcgcggcaggggtcttcatgcccatcggcatcgtgctacagccgtggatgggctcagcggccatggcggcctcctccgtgtctgtggttctctcgtcgctgcaactcaagtgctataagaagcccgacctggagaggtatgaggcccaggcccagggccgcatgaagcccctgactgcgtcccaggtcagcgtgcacgttggcatggatgaccggcgacgggactcaccgagggccacgccctgggaccaggcctccgggagcttcagattacatggtctgctgcgtgaccgtcacctcgtggcattcattcagaactcctgccaggcgtgcccctggtggtgtgcaactccaagcaaacaacgatacccaaatcagaggaaatcagttattctccatgagctcctacttctgcaccctgagtcagtgccttaggaaaggagtcaccacaccttccccaagggaaagtctttcacactttgagtggctctttgtggtggggcaggaatggggccagttttagactctaaagtcggtggtagttgacagaactacatgggagttagacgagtagggtgaaataaattttaaggtagagccctgatcgcatacacagaataattttatttattgagtatcagttatttttcagggacaatataagcactttctataggttacctctaatcctcccagcataccagcaaagtagatacgattgtccgcattttataggcggggcagtaggcccagagaggctacgtatcctgtccaggatcacacagccagcacgcttgccaaaacggggatccaaagccatgtctcttggcgctgaagtcttttctttattgccgctgccacccgaatatcagtttggtaagaataaataggaaaagggcacttggctctcagaagaacaaagctgccaggcagtacactcattgttatcaactgggcatgaaatttgaccgtggggtcaacttcctcaccttctccttggatggtctgtttccattttcgcatatgattccattctgttgggtcttgccctctaagatgcaagtgcagggttctgtagtgcctctatcattttcagtcttcctctccttccaggccccttcccgttcttcccttcctttattcctggctgtgcttgggagtgtttcttgttttcttaactaggttaatcattgtctaaagaatctaactgcattgatttttttcaaaggcttttaggaccataaacatcatgtgtatatggccatgaaaatatttatataattgcacagaatgtaacctttagatgttcaaggggtaaggatttttgtgtgcgtcagataagagcagtccctattccaaaaactttccatgctgtattagaataaagtttatttttattcatctgaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]